Incidental Mutation 'R4520:Serpinb9c'
ID334192
Institutional Source Beutler Lab
Gene Symbol Serpinb9c
Ensembl Gene ENSMUSG00000021404
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9c
SynonymsNK9, Spi11, ovalbumin, 3830421J05Rik
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33149275-33159742 bp(-) (GRCm38)
Type of Mutationunclassified (4612 bp from exon)
DNA Base Change (assembly) T to C at 33151857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021837] [ENSMUST00000110284] [ENSMUST00000135897]
Predicted Effect probably damaging
Transcript: ENSMUST00000021837
AA Change: Y232C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021837
Gene: ENSMUSG00000021404
AA Change: Y232C

DomainStartEndE-ValueType
SERPIN 24 387 2.85e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110284
AA Change: Y204C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105913
Gene: ENSMUSG00000021404
AA Change: Y204C

DomainStartEndE-ValueType
SERPIN 1 359 1.21e-146 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135897
SMART Domains Protein: ENSMUSP00000116267
Gene: ENSMUSG00000021404

DomainStartEndE-ValueType
Pfam:Serpin 1 88 7.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2b10 T C 7: 25,911,557 V113A probably benign Het
Cyp2c50 A G 19: 40,090,689 T159A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Esr2 G A 12: 76,167,549 P43S possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Prkag2 A G 5: 24,866,171 V403A probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Serpinb9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Serpinb9c APN 13 33151884 missense probably damaging 0.98
IGL01357:Serpinb9c APN 13 33151879 missense probably benign 0.02
IGL01413:Serpinb9c APN 13 33151804 missense probably damaging 0.99
R1411:Serpinb9c UTSW 13 33151834 missense probably benign 0.02
R1926:Serpinb9c UTSW 13 33150235 missense probably benign 0.00
R2057:Serpinb9c UTSW 13 33156871 nonsense probably null
R2058:Serpinb9c UTSW 13 33156871 nonsense probably null
R2059:Serpinb9c UTSW 13 33156871 nonsense probably null
R2272:Serpinb9c UTSW 13 33154541 missense probably damaging 1.00
R3948:Serpinb9c UTSW 13 33150094 missense probably benign
R4558:Serpinb9c UTSW 13 33154499 missense probably benign 0.12
R4735:Serpinb9c UTSW 13 33150271 missense probably benign 0.13
R5004:Serpinb9c UTSW 13 33150355 missense probably benign 0.00
R5009:Serpinb9c UTSW 13 33154431 missense probably benign 0.18
R6345:Serpinb9c UTSW 13 33149995 missense probably damaging 1.00
R6801:Serpinb9c UTSW 13 33157824 start codon destroyed probably benign 0.00
R6886:Serpinb9c UTSW 13 33150327 missense probably benign 0.04
R7082:Serpinb9c UTSW 13 33154407 missense probably benign 0.40
R7288:Serpinb9c UTSW 13 33151900 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCTGGGTTTGTGAGTACCAC -3'
(R):5'- TGTGAGTGCTGTAAACAATTCC -3'

Sequencing Primer
(F):5'- TGTGAGTACCACCCTCTAAAAATGG -3'
(R):5'- CCAGAATTAATGGCAGTTGATCTGG -3'
Posted On2015-08-18