Incidental Mutation 'R4520:Cyp2c50'
ID334200
Institutional Source Beutler Lab
Gene Symbol Cyp2c50
Ensembl Gene ENSMUSG00000054827
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 50
Synonyms
MMRRC Submission 041763-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4520 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location40089688-40113950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40090689 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000079065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068094] [ENSMUST00000080171]
Predicted Effect probably benign
Transcript: ENSMUST00000068094
AA Change: T159A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000068039
Gene: ENSMUSG00000054827
AA Change: T159A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 225 3.7e-54 PFAM
Pfam:p450 213 428 6.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080171
AA Change: T159A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000079065
Gene: ENSMUSG00000054827
AA Change: T159A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1.2e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124391
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,070,266 T1739A probably damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cel C T 2: 28,557,968 V349M probably benign Het
Cspp1 A G 1: 10,134,227 T1127A probably benign Het
Cyp2b10 T C 7: 25,911,557 V113A probably benign Het
Degs1 T C 1: 182,276,808 D304G possibly damaging Het
Esr2 G A 12: 76,167,549 P43S possibly damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Gm5444 A G 13: 4,834,226 noncoding transcript Het
Golga3 T A 5: 110,203,751 L790* probably null Het
Gtpbp6 T C 5: 110,107,859 T105A probably benign Het
Ido2 T C 8: 24,576,178 E24G probably damaging Het
Ihh T A 1: 74,950,950 I89F probably damaging Het
Krt13 A G 11: 100,119,348 M269T probably damaging Het
Marf1 T C 16: 14,132,666 H952R probably damaging Het
Mga T A 2: 119,948,098 F2041L possibly damaging Het
Msmo1 A C 8: 64,720,523 probably benign Het
Mterf1a A G 5: 3,890,992 V292A probably damaging Het
Naxe A G 3: 88,057,982 probably null Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr1097 T C 2: 86,891,019 D52G probably benign Het
Olfr572 A T 7: 102,928,557 I310F probably benign Het
Olfr657 T A 7: 104,636,169 V165E probably damaging Het
Otog T A 7: 46,241,053 probably benign Het
Pigo A T 4: 43,020,301 H880Q probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Pole T A 5: 110,297,924 D555E probably damaging Het
Prkag2 A G 5: 24,866,171 V403A probably damaging Het
Psg28 T A 7: 18,422,901 M470L probably benign Het
Rpgrip1 A G 14: 52,152,289 T1138A probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serpinb9c T C 13: 33,151,857 probably null Het
Sh2d6 T C 6: 72,518,953 N101D possibly damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc13a1 T C 6: 24,134,513 T124A probably benign Het
Slc6a3 G A 13: 73,540,856 V100M possibly damaging Het
Sspn A G 6: 145,961,307 T79A probably benign Het
Tlr8 C T X: 167,243,175 R893H probably damaging Het
Tnrc18 T C 5: 142,732,150 K2183R unknown Het
Trim15 T C 17: 36,866,350 I139M probably benign Het
Trmt13 A T 3: 116,581,613 probably null Het
Vmn2r84 T A 10: 130,386,522 T610S probably damaging Het
Zcchc14 A T 8: 121,609,095 probably benign Het
Other mutations in Cyp2c50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Cyp2c50 APN 19 40092284 missense probably benign 0.12
IGL01463:Cyp2c50 APN 19 40090978 missense probably damaging 1.00
IGL01669:Cyp2c50 APN 19 40098051 missense probably damaging 1.00
IGL02008:Cyp2c50 APN 19 40091099 nonsense probably null
IGL02331:Cyp2c50 APN 19 40090943 critical splice acceptor site probably null
IGL02830:Cyp2c50 APN 19 40098056 missense probably benign 0.00
R0115:Cyp2c50 UTSW 19 40092393 splice site probably benign
R1666:Cyp2c50 UTSW 19 40091055 missense probably benign
R1668:Cyp2c50 UTSW 19 40091055 missense probably benign
R1679:Cyp2c50 UTSW 19 40111415 missense possibly damaging 0.93
R2425:Cyp2c50 UTSW 19 40089848 missense probably benign 0.20
R2509:Cyp2c50 UTSW 19 40090569 missense probably benign
R2570:Cyp2c50 UTSW 19 40090320 missense probably benign 0.01
R3040:Cyp2c50 UTSW 19 40098126 missense probably benign 0.02
R3983:Cyp2c50 UTSW 19 40113518 missense possibly damaging 0.64
R4425:Cyp2c50 UTSW 19 40090692 missense possibly damaging 0.94
R4484:Cyp2c50 UTSW 19 40090639 missense probably damaging 1.00
R4820:Cyp2c50 UTSW 19 40113580 missense probably damaging 1.00
R4978:Cyp2c50 UTSW 19 40098057 missense probably damaging 1.00
R5335:Cyp2c50 UTSW 19 40090616 missense probably benign 0.00
R5807:Cyp2c50 UTSW 19 40113500 missense probably damaging 1.00
R5955:Cyp2c50 UTSW 19 40090943 critical splice acceptor site probably null
R6553:Cyp2c50 UTSW 19 40090602 missense probably benign 0.41
R6560:Cyp2c50 UTSW 19 40096855 missense probably benign 0.03
R7241:Cyp2c50 UTSW 19 40090568 missense probably benign
R7389:Cyp2c50 UTSW 19 40090663 missense probably benign 0.01
R7511:Cyp2c50 UTSW 19 40092190 splice site probably null
Z1088:Cyp2c50 UTSW 19 40097955 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TATGGCAGCCACCAGACATC -3'
(R):5'- ACCATGCCCTTGTTATCATGTTAAG -3'

Sequencing Primer
(F):5'- AGACATCCTCTACTTCTACTCCAGG -3'
(R):5'- CCCTTGTTATCATGTTAAGACACTTG -3'
Posted On2015-08-18