Incidental Mutation 'R4521:Olfr623'
ID334223
Institutional Source Beutler Lab
Gene Symbol Olfr623
Ensembl Gene ENSMUSG00000099687
Gene Nameolfactory receptor 623
SynonymsMOR1-4, GA_x6K02T2PBJ9-6384836-6383883
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103657697-103663698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103660332 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 306 (R306H)
Ref Sequence ENSEMBL: ENSMUSP00000150141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068531] [ENSMUST00000213840]
Predicted Effect probably benign
Transcript: ENSMUST00000068531
AA Change: R306H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: R306H

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1.7e-112 PFAM
Pfam:7TM_GPCR_Srsx 36 299 3.1e-7 PFAM
Pfam:7tm_1 42 293 2.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213840
AA Change: R306H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Olfr623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr623 APN 7 103661067 missense probably damaging 0.99
IGL01669:Olfr623 APN 7 103660987 missense probably benign 0.02
IGL01731:Olfr623 APN 7 103660846 missense probably benign 0.01
IGL02057:Olfr623 APN 7 103660653 missense probably damaging 1.00
IGL02249:Olfr623 APN 7 103660366 missense probably damaging 0.99
IGL02937:Olfr623 APN 7 103660905 missense probably damaging 1.00
IGL03113:Olfr623 APN 7 103660644 missense possibly damaging 0.90
R0413:Olfr623 UTSW 7 103660750 missense possibly damaging 0.52
R0862:Olfr623 UTSW 7 103660528 missense probably damaging 1.00
R1262:Olfr623 UTSW 7 103660441 missense probably benign 0.33
R1791:Olfr623 UTSW 7 103660798 unclassified probably null
R2327:Olfr623 UTSW 7 103660572 missense probably damaging 1.00
R2338:Olfr623 UTSW 7 103660410 missense possibly damaging 0.90
R4831:Olfr623 UTSW 7 103660471 missense probably benign 0.40
R5322:Olfr623 UTSW 7 103660672 missense possibly damaging 0.62
R6270:Olfr623 UTSW 7 103660413 missense possibly damaging 0.48
R6959:Olfr623 UTSW 7 103660843 missense probably damaging 1.00
R7157:Olfr623 UTSW 7 103660581 missense probably damaging 1.00
R7181:Olfr623 UTSW 7 103660813 missense probably damaging 0.99
X0066:Olfr623 UTSW 7 103660660 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AAGTGAGATCTTTACATGGTGCTTC -3'
(R):5'- TCAACACATGTGTCTCCCATATCTG -3'

Sequencing Primer
(F):5'- TGTTTCTCCTGCCTGAAAT -3'
(R):5'- GTTGCATCTTGGTCTTCTATGTCAC -3'
Posted On2015-08-18