Incidental Mutation 'R4521:Olfr810'
ID334232
Institutional Source Beutler Lab
Gene Symbol Olfr810
Ensembl Gene ENSMUSG00000069421
Gene Nameolfactory receptor 810
SynonymsMOR113-4, GA_x6K02T2PULF-11470271-11469333
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129787289-129794917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129791181 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 136 (N136I)
Ref Sequence ENSEMBL: ENSMUSP00000150364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091986
AA Change: N136I

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: N136I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 7.3e-50 PFAM
Pfam:7tm_1 39 288 5e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214206
AA Change: N136I

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214878
AA Change: N136I

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217283
AA Change: N136I

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Ppwd1 A G 13: 104,209,659 V496A probably benign Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Olfr810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr810 APN 10 129791319 missense probably damaging 0.98
IGL02365:Olfr810 APN 10 129791535 missense possibly damaging 0.81
IGL02508:Olfr810 APN 10 129790791 missense probably benign 0.44
R0638:Olfr810 UTSW 10 129791232 missense probably damaging 1.00
R0680:Olfr810 UTSW 10 129790818 missense probably damaging 1.00
R0847:Olfr810 UTSW 10 129791458 missense probably damaging 1.00
R1449:Olfr810 UTSW 10 129790854 missense probably damaging 1.00
R1776:Olfr810 UTSW 10 129791131 missense probably benign 0.00
R1938:Olfr810 UTSW 10 129790890 missense probably damaging 1.00
R3836:Olfr810 UTSW 10 129791170 missense probably benign 0.01
R4816:Olfr810 UTSW 10 129791439 missense probably damaging 1.00
R6287:Olfr810 UTSW 10 129791385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTAAGAGTGTTACCAAAGCTG -3'
(R):5'- ACATGCATCCCCAAATTGCTTG -3'

Sequencing Primer
(F):5'- CTGAGACAAATCCCATTGTTTCCAGG -3'
(R):5'- CCCAAATTGCTTGTTACTATGGCAAC -3'
Posted On2015-08-18