Incidental Mutation 'R4521:Ppwd1'
ID334236
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Namepeptidylprolyl isomerase domain and WD repeat containing 1
Synonyms4632422M10Rik, A330090G21Rik
MMRRC Submission 041764-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R4521 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104205124-104228843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104209659 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 496 (V496A)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
Predicted Effect probably benign
Transcript: ENSMUST00000022226
AA Change: V496A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: V496A

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Bora G T 14: 99,068,548 S451I probably damaging Het
Cadm3 A T 1: 173,345,063 probably null Het
Car14 A G 3: 95,904,378 probably benign Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdc20b A G 13: 113,081,191 I381M probably damaging Het
Col12a1 C T 9: 79,633,357 V2449I probably benign Het
Crb2 T C 2: 37,795,337 probably benign Het
Dcaf6 A T 1: 165,390,490 D347E probably damaging Het
Dlgap2 G A 8: 14,727,871 R372H probably damaging Het
Fat3 T C 9: 15,922,942 N4118S probably null Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fpr2 A C 17: 17,893,247 R168S probably benign Het
Ghr A G 15: 3,325,958 I281T probably damaging Het
Glmp C A 3: 88,328,039 N259K possibly damaging Het
Grhl3 T C 4: 135,546,250 K564E probably damaging Het
Helz2 T C 2: 181,228,833 H2875R probably benign Het
Lcp1 A G 14: 75,215,168 D438G possibly damaging Het
Lrfn2 T A 17: 49,069,894 M1K probably null Het
Lrp6 A G 6: 134,485,862 C612R probably damaging Het
Map3k13 T C 16: 21,905,775 V341A possibly damaging Het
Megf8 T A 7: 25,342,701 C1315S probably benign Het
Mrgpra9 A T 7: 47,235,190 L243H probably damaging Het
Mrgprx1 T C 7: 48,021,699 D100G probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nup93 T C 8: 94,314,636 Y801H probably damaging Het
Olfr623 C T 7: 103,660,332 R306H probably benign Het
Olfr810 T A 10: 129,791,181 N136I possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Plpp2 A G 10: 79,530,625 Y118H probably damaging Het
Rbm20 A G 19: 53,817,202 N466S probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Skida1 T C 2: 18,045,872 probably benign Het
Stk17b A G 1: 53,764,038 Y73H probably damaging Het
Tapbpl A G 6: 125,228,122 I287T probably damaging Het
Tmem38a C T 8: 72,572,161 P20S possibly damaging Het
Topbp1 T C 9: 103,334,202 probably benign Het
Tsen54 G A 11: 115,817,106 probably null Het
Ttn G A 2: 76,725,216 R28736* probably null Het
Wdr36 G A 18: 32,841,148 probably null Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCTCACAATAGGCTGCATTAAAAG -3'
(R):5'- GGTAAGTTGTTTAATTCAGCTGCTCAC -3'

Sequencing Primer
(F):5'- GGCTGCATTAAAAGTAATCTTTCTC -3'
(R):5'- GTTTAATTCAGCTGCTCACATTTTC -3'
Posted On2015-08-18