Incidental Mutation 'R4524:Ralgapb'
ID334352
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
MMRRC Submission 041766-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4524 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 158437306 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 104 (T104N)
Ref Sequence ENSEMBL: ENSMUSP00000116481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]
Predicted Effect probably benign
Transcript: ENSMUST00000046274
AA Change: T416N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: T416N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109485
AA Change: T416N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: T416N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109486
AA Change: T416N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: T416N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141497
AA Change: T104N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652
AA Change: T104N

DomainStartEndE-ValueType
low complexity region 288 303 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173137
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,302,917 S962G probably benign Het
Ackr2 T C 9: 121,909,543 V328A probably benign Het
Ang4 G T 14: 51,764,148 C114* probably null Het
Arid1b A T 17: 5,097,620 Q599L possibly damaging Het
Ascc3 A G 10: 50,660,670 N700D probably benign Het
Atrnl1 A G 19: 57,630,306 D152G probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Birc6 C T 17: 74,641,777 T3067I probably damaging Het
Bmpr2 T C 1: 59,867,412 S555P probably benign Het
Brox A T 1: 183,292,481 L68I possibly damaging Het
C130026L21Rik A G 5: 111,585,872 noncoding transcript Het
Cavin2 T C 1: 51,301,070 V302A probably benign Het
Cbln3 A T 14: 55,884,065 C41* probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Clec4a2 T A 6: 123,125,084 I66N probably damaging Het
Ddx27 T A 2: 167,027,720 C358* probably null Het
Ehbp1 A T 11: 22,151,843 D228E probably damaging Het
Emc7 T C 2: 112,455,264 V66A probably damaging Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Furin T C 7: 80,398,634 probably null Het
Gm3739 T A 14: 7,299,398 K86* probably null Het
Gmpr A T 13: 45,529,739 E162V probably damaging Het
Gtpbp4 A T 13: 8,974,294 V541D probably benign Het
Myh2 G T 11: 67,176,270 G184W probably damaging Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Nrg4 T G 9: 55,227,902 probably benign Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfr298 G T 7: 86,488,826 H242N probably damaging Het
Olfr874 T C 9: 37,746,866 L244S possibly damaging Het
Pde7a T A 3: 19,230,976 H349L possibly damaging Het
Pds5b A T 5: 150,788,316 D913V probably damaging Het
Plce1 T C 19: 38,524,319 S21P possibly damaging Het
Rapgef1 A G 2: 29,679,246 I59V probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Rsph6a C T 7: 19,066,045 H534Y probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shcbp1 T C 8: 4,739,193 Y542C probably damaging Het
Shisa8 C G 15: 82,211,962 V151L possibly damaging Het
Slc7a8 G A 14: 54,737,602 T190I probably damaging Het
Spire2 T A 8: 123,360,235 S382T probably benign Het
Stard9 A G 2: 120,696,445 D1061G probably damaging Het
Tex44 T G 1: 86,427,576 D402E probably benign Het
Thbs1 G T 2: 118,122,979 R959L probably damaging Het
Tiam2 A G 17: 3,514,711 D1408G probably damaging Het
Trrap C T 5: 144,825,321 T2352I probably benign Het
Tspyl5 T A 15: 33,687,592 E69V probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Washc1 C T 17: 66,119,092 Q462* probably null Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0581:Ralgapb UTSW 2 158492961 missense probably benign
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1331:Ralgapb UTSW 2 158430533 missense probably damaging 1.00
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5465:Ralgapb UTSW 2 158448405 missense possibly damaging 0.81
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7108:Ralgapb UTSW 2 158494662 missense probably damaging 1.00
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7454:Ralgapb UTSW 2 158432902 missense possibly damaging 0.94
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CGGGCTGTTACTGTGAACAAG -3'
(R):5'- GGGGATAATGACTACATGTTTCTGG -3'

Sequencing Primer
(F):5'- GCTGTTACTGTGAACAAGGCCAC -3'
(R):5'- GGGCATATTTACCAGTCATGC -3'
Posted On2015-08-18