Incidental Mutation 'R0208:Spta1'
ID33444
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R0208 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174192960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 545 (H545R)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably damaging
Transcript: ENSMUST00000027817
AA Change: H545R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: H545R

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense not run
R7087:Spta1 UTSW 1 174174510 missense not run
R7151:Spta1 UTSW 1 174197751 missense not run
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAAAAGGCAATCATGTAGCCA -3'
(R):5'- AGTTGAGATCACTGCCCACCCT -3'

Sequencing Primer
(F):5'- GCAATCATGTAGCCAAGAGTG -3'
(R):5'- gcttccgttcctgacacc -3'
Posted On2013-05-09