Incidental Mutation 'R4526:Vmn2r60'
ID334444
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 041591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4526 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42195243 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 677 (T677A)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably damaging
Transcript: ENSMUST00000166447
AA Change: T677A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: T677A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,578 R178C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgre4 C A 17: 55,785,016 S92* probably null Het
Arl13b T C 16: 62,812,011 D73G probably damaging Het
Cbwd1 A G 19: 24,957,964 Y59H probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Crebzf A C 7: 90,443,760 E16A possibly damaging Het
D430041D05Rik A G 2: 104,192,433 probably null Het
Dnah1 C A 14: 31,285,998 D2151Y probably benign Het
Gli3 A G 13: 15,713,631 K544E probably damaging Het
Gm17542 T C 10: 58,713,613 D31G probably null Het
Lcn9 A C 2: 25,824,508 K128T possibly damaging Het
Lman2l T C 1: 36,438,763 E164G probably damaging Het
Lpin2 T A 17: 71,237,378 probably null Het
Ly75 G A 2: 60,330,773 T900M probably benign Het
Mapk15 A T 15: 75,995,255 I74F possibly damaging Het
Myh10 C T 11: 68,815,049 T2007I probably benign Het
Nek1 T C 8: 61,106,944 S937P probably damaging Het
Oas1b T A 5: 120,822,102 probably null Het
Olfr1098 C T 2: 86,922,995 C179Y possibly damaging Het
Olfr1156 T C 2: 87,949,409 T275A probably benign Het
Olfr1269 T C 2: 90,118,672 K309E probably benign Het
Otogl G A 10: 107,886,980 P297S probably damaging Het
Plekhm1 A G 11: 103,395,304 S102P probably damaging Het
Plvap G A 8: 71,507,771 R334W probably damaging Het
Polr2b T G 5: 77,326,714 V466G probably damaging Het
Ptpn13 T C 5: 103,501,469 I246T probably benign Het
Rims2 A T 15: 39,437,717 K281N probably damaging Het
Scamp4 T C 10: 80,611,057 F108S probably damaging Het
Snrnp200 A G 2: 127,229,102 N1101S probably benign Het
Sntb2 C A 8: 107,009,963 L490M probably damaging Het
Ssu2 A G 6: 112,382,422 V79A possibly damaging Het
Stard7 A G 2: 127,297,208 S347G probably benign Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r6 A G 3: 64,537,724 V860A probably benign Het
Zfp318 T A 17: 46,412,358 H1762Q probably benign Het
Zmynd8 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 165,807,607 probably benign Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7529:Vmn2r60 UTSW 7 42195734 frame shift probably null
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGACACACCCATTGTCAAGG -3'
(R):5'- CTGTTGAACCCATGTTGCACAC -3'

Sequencing Primer
(F):5'- TTGTCAAGGCCAATAACAGGACTCTC -3'
(R):5'- GTTGCACACAATGATGATGTGACC -3'
Posted On2015-08-18