Incidental Mutation 'R4513:Msh5'
ID334540
Institutional Source Beutler Lab
Gene Symbol Msh5
Ensembl Gene ENSMUSG00000007035
Gene NamemutS homolog 5
SynonymsMut5, G7
MMRRC Submission 041759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4513 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35028605-35046745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35030688 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 627 (I627N)
Ref Sequence ENSEMBL: ENSMUSP00000094951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007245] [ENSMUST00000007250] [ENSMUST00000040151] [ENSMUST00000097338] [ENSMUST00000172499] [ENSMUST00000172536] [ENSMUST00000174037] [ENSMUST00000174117] [ENSMUST00000174603]
Predicted Effect probably benign
Transcript: ENSMUST00000007245
SMART Domains Protein: ENSMUSP00000007245
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 499 2.59e0 SMART
low complexity region 683 701 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 864 877 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000007250
AA Change: I627N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007250
Gene: ENSMUSG00000007035
AA Change: I627N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040151
SMART Domains Protein: ENSMUSP00000047448
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
Pfam:Suppressor_APC 35 114 2.1e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097338
AA Change: I627N

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094951
Gene: ENSMUSG00000007035
AA Change: I627N

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
MUTSac 584 775 2.2e-61 SMART
Blast:MUTSac 795 833 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172499
SMART Domains Protein: ENSMUSP00000133418
Gene: ENSMUSG00000007030

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VWA 314 478 7.28e0 SMART
low complexity region 662 680 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
low complexity region 843 856 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172536
SMART Domains Protein: ENSMUSP00000134426
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 568 9.72e-72 SMART
low complexity region 604 615 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173211
Predicted Effect probably benign
Transcript: ENSMUST00000174026
SMART Domains Protein: ENSMUSP00000134295
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
MUTSac 1 166 4e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174037
SMART Domains Protein: ENSMUSP00000133881
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174117
SMART Domains Protein: ENSMUSP00000134423
Gene: ENSMUSG00000036185

DomainStartEndE-ValueType
low complexity region 55 65 N/A INTRINSIC
low complexity region 70 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174603
SMART Domains Protein: ENSMUSP00000134065
Gene: ENSMUSG00000007035

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
MUTSd 248 493 1.67e-11 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the MutS family of proteins that play critical roles in DNA mismatch repair and meiotic homologous recombination processes. Mice lacking the encoded protein are viable but sterile, with severe defects in spermatogenesis in males and complete loss of ovarian structures in females. Mutations in a similar gene in humans have been shown to cause common variable immune deficiency (CVID) and immunoglobulin A deficiency. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted chromosome pairing in meiosis I resulting in cell death and sterility. In males, testes size is reduced, and in females, there is a total loss of ovarian structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik G T 8: 45,968,138 T116K probably damaging Het
Adgre1 A G 17: 57,410,947 I320V probably benign Het
Akap6 T C 12: 52,796,004 V45A probably benign Het
Ankrd28 A T 14: 31,743,285 S312T probably damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Cntn3 A T 6: 102,168,982 I966N probably benign Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Dmxl2 A C 9: 54,419,884 S952R probably null Het
Dopey1 G A 9: 86,520,559 E1271K probably benign Het
Fgfr3 A G 5: 33,723,116 probably benign Het
Gm10110 A G 14: 89,897,715 noncoding transcript Het
Gm13089 T C 4: 143,698,148 M242V probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Guf1 T C 5: 69,561,662 V230A probably benign Het
Hsd17b14 C T 7: 45,562,915 L124F probably benign Het
Id3 G T 4: 136,144,358 probably benign Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Lgr4 T C 2: 110,012,016 M782T possibly damaging Het
Lsm12 T C 11: 102,167,083 probably null Het
Map1b T A 13: 99,444,233 D117V probably damaging Het
Map3k11 A G 19: 5,702,210 T807A probably damaging Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mapkbp1 T A 2: 120,023,693 I1257N possibly damaging Het
Mcm3 A G 1: 20,810,232 Y459H probably damaging Het
Mkln1 T C 6: 31,433,158 probably benign Het
Nfkbiz T C 16: 55,816,841 H488R probably benign Het
Nrg1 G T 8: 32,477,077 probably benign Het
Olfr1477 A T 19: 13,502,622 Y93F probably benign Het
Olfr348 A G 2: 36,786,770 M82V probably benign Het
Olfr574 T C 7: 102,948,738 L81P probably damaging Het
Olfr635 T C 7: 103,979,441 V89A probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhg4 T A 8: 105,380,402 C910S probably damaging Het
Ppp1r18 A G 17: 35,868,304 E357G probably damaging Het
Rbm11 T C 16: 75,596,587 F57S probably damaging Het
Sbp G A 17: 23,945,312 G183D probably benign Het
Skint5 A G 4: 113,742,185 V719A unknown Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc29a1 A C 17: 45,589,066 Y232* probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
Spanxn4 A T 12: 62,688,100 noncoding transcript Het
Spata31d1d T C 13: 59,728,554 Q389R probably benign Het
Srgap1 A G 10: 121,870,326 probably null Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Tle2 A G 10: 81,587,560 D491G probably damaging Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trav6-3 A G 14: 53,430,091 T7A probably benign Het
Ube2q2 C A 9: 55,149,800 P56T probably benign Het
Unc79 T C 12: 103,021,760 V208A probably damaging Het
Xkr7 T C 2: 153,054,633 I469T probably benign Het
Other mutations in Msh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Msh5 APN 17 35029881 nonsense probably null
IGL00491:Msh5 APN 17 35030730 missense probably damaging 0.96
IGL01364:Msh5 APN 17 35028769 missense possibly damaging 0.70
R0189:Msh5 UTSW 17 35029654 missense probably null 0.97
R0257:Msh5 UTSW 17 35032864 missense probably damaging 0.99
R0346:Msh5 UTSW 17 35029888 missense probably benign 0.09
R0449:Msh5 UTSW 17 35041482 missense probably benign 0.09
R0645:Msh5 UTSW 17 35039223 missense probably damaging 1.00
R1925:Msh5 UTSW 17 35029952 missense probably benign 0.00
R1929:Msh5 UTSW 17 35044390 missense probably benign 0.24
R1970:Msh5 UTSW 17 35033600 missense probably damaging 0.99
R2025:Msh5 UTSW 17 35032792 missense possibly damaging 0.90
R2038:Msh5 UTSW 17 35046040 missense probably benign 0.12
R2058:Msh5 UTSW 17 35029756 missense probably damaging 0.99
R2271:Msh5 UTSW 17 35044390 missense probably benign 0.24
R2408:Msh5 UTSW 17 35045119 missense probably damaging 1.00
R3079:Msh5 UTSW 17 35046232 missense probably benign 0.41
R4409:Msh5 UTSW 17 35039250 missense probably damaging 0.98
R4878:Msh5 UTSW 17 35038456 missense probably damaging 1.00
R4951:Msh5 UTSW 17 35038420 nonsense probably null
R5037:Msh5 UTSW 17 35032393 missense possibly damaging 0.80
R5063:Msh5 UTSW 17 35042188 splice site probably null
R5064:Msh5 UTSW 17 35043783 intron probably benign
R5103:Msh5 UTSW 17 35029239 missense possibly damaging 0.96
R5872:Msh5 UTSW 17 35029652 critical splice donor site probably null
R6320:Msh5 UTSW 17 35029924 missense probably damaging 0.97
R6869:Msh5 UTSW 17 35041834 intron probably null
R6997:Msh5 UTSW 17 35030002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATGCATGCATTGGAGG -3'
(R):5'- AATTGTGAAGTCAGGACCCAGG -3'

Sequencing Primer
(F):5'- GAAATGTGTTCCTGCCCAAG -3'
(R):5'- AAACTGTGTTCCAGGGCTC -3'
Posted On2015-08-18