Incidental Mutation 'R3081:Als2'
ID334554
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 040571-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.854) question?
Stock #R3081 (G1)
Quality Score78
Status Validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59187349 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 932 (L932P)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably damaging
Transcript: ENSMUST00000027178
AA Change: L932P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: L932P

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159166
Predicted Effect probably damaging
Transcript: ENSMUST00000163058
AA Change: L932P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: L932P

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamdc T A 7: 97,565,225 T48S probably benign Het
Abcc3 T A 11: 94,356,976 L1230F probably damaging Het
Abcf3 T A 16: 20,559,364 I542N probably benign Het
Arhgap45 G A 10: 80,026,447 R583H probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Bcl9 A T 3: 97,205,673 N1155K possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cdkn2aip T C 8: 47,711,497 K394E probably damaging Het
Cfap70 A G 14: 20,420,762 Y472H probably damaging Het
Cfap77 T A 2: 28,962,650 K203N probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Coro6 T C 11: 77,468,912 F336S probably damaging Het
Derl1 C A 15: 57,875,611 probably benign Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock2 T A 11: 34,231,610 H1651L probably benign Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Dzip3 T C 16: 48,927,558 H1163R probably damaging Het
Efcab9 T C 11: 32,523,689 D35G probably benign Het
Evpl T C 11: 116,220,852 D2004G probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fastkd3 T C 13: 68,584,868 V436A probably benign Het
Fbxl5 A G 5: 43,750,880 Y660H probably damaging Het
Glt8d1 T C 14: 31,006,660 V15A probably benign Het
Gpr25 A C 1: 136,259,885 I330S possibly damaging Het
Hdac5 A T 11: 102,205,610 V257E probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Mgat3 A G 15: 80,211,854 D294G probably benign Het
Mylk2 A G 2: 152,919,354 N459S probably benign Het
Myo3b A C 2: 70,256,583 probably benign Het
Naip6 T C 13: 100,300,453 T521A probably benign Het
Nfxl1 C T 5: 72,529,035 A608T possibly damaging Het
Nmd3 A G 3: 69,724,399 probably benign Het
Nol8 C T 13: 49,678,392 probably benign Het
Olfr389 A T 11: 73,777,225 M34K probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr901 T A 9: 38,431,056 M258K possibly damaging Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcdhgb2 T C 18: 37,691,513 F519S probably damaging Het
Phf11c A G 14: 59,381,484 V284A probably benign Het
Rasl11a G T 5: 146,847,303 C186F probably benign Het
Rps18-ps3 T C 8: 107,262,837 noncoding transcript Het
Rusc1 A G 3: 89,091,723 S251P possibly damaging Het
Rxfp3 T C 15: 11,037,217 E23G probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc22a4 A G 11: 54,007,789 V159A probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Stip1 C T 19: 7,035,648 A23T probably benign Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmed4 T C 11: 6,274,151 H115R probably benign Het
Tmem255b T A 8: 13,451,048 L74H probably damaging Het
Trav6n-5 A T 14: 53,105,284 H93L possibly damaging Het
Tsen54 T A 11: 115,820,164 D187E probably benign Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Vmn2r88 A G 14: 51,418,632 N775S probably damaging Het
Vps13a G T 19: 16,664,737 N2175K probably benign Het
Wnk4 A G 11: 101,276,891 probably benign Het
Zfp180 A T 7: 24,105,503 Q449L probably damaging Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6222:Als2 UTSW 1 59180125 missense probably benign 0.04
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGCCTGGGTCTACAGTAG -3'
(R):5'- CTCCTGTGTGGTCCTAAAATCTAG -3'

Sequencing Primer
(F):5'- GGCTGTACCTTCCAGATTTCTATGAG -3'
(R):5'- TTTAGGAAACGTCTGATGCAGC -3'
Posted On2015-08-28