Incidental Mutation 'R2859:Ism2'
ID334560
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2859 (G1)
Quality Score39
Status Validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87299663 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 15 (M15V)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125733]
Predicted Effect unknown
Transcript: ENSMUST00000125733
AA Change: M15V
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: M15V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Meta Mutation Damage Score 0.1096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAGAGTGTAAACTCCTGCG -3'
(R):5'- TTTCCCGGGACAGGAATTC -3'

Sequencing Primer
(F):5'- TAAACTCCTGCGGGCTCAGTG -3'
(R):5'- ACAGGAATTCGCTTGGGGC -3'
Posted On2015-09-02