Incidental Mutation 'R3625:Nkx6-2'
ID334568
Institutional Source Beutler Lab
Gene Symbol Nkx6-2
Ensembl Gene ENSMUSG00000041309
Gene NameNK6 homeobox 2
SynonymsGtx, Nkx6.2
MMRRC Submission 040679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3625 (G1)
Quality Score67
Status Validated
Chromosome7
Chromosomal Location139579376-139582797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139582190 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 117 (F117S)
Ref Sequence ENSEMBL: ENSMUSP00000101701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097974] [ENSMUST00000097975] [ENSMUST00000106095] [ENSMUST00000106098]
Predicted Effect probably benign
Transcript: ENSMUST00000026550
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097974
AA Change: F117S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095588
Gene: ENSMUSG00000041309
AA Change: F117S

DomainStartEndE-ValueType
low complexity region 64 85 N/A INTRINSIC
HOX 148 210 8.32e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097975
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106095
AA Change: F117S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101701
Gene: ENSMUSG00000041309
AA Change: F117S

DomainStartEndE-ValueType
low complexity region 64 85 N/A INTRINSIC
HOX 148 210 8.32e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106098
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination at 6 weeks of age and axon degeneration in the optic nerve at 7 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg3 T A 16: 45,175,261 I119N probably benign Het
Cdh12 G C 15: 21,358,756 V89L probably damaging Het
Cdh3 C A 8: 106,543,678 H396N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dab2ip C A 2: 35,643,891 S43* probably null Het
Dmxl2 A G 9: 54,393,643 S2394P probably benign Het
F13a1 T G 13: 36,898,093 N546H probably benign Het
Fbn2 T C 18: 58,061,742 N1449S probably damaging Het
Flywch1 T C 17: 23,760,201 probably benign Het
Gm10436 T C 12: 88,175,961 S296G probably benign Het
Gm498 T C 7: 143,871,854 V80A possibly damaging Het
Grxcr2 T A 18: 41,998,818 D62V probably damaging Het
Hist1h2bg T C 13: 23,571,451 probably benign Het
Ifnab A T 4: 88,690,779 I150N probably damaging Het
Igsf8 T C 1: 172,317,769 V284A probably benign Het
Kdm1a T C 4: 136,561,108 E388G possibly damaging Het
Map3k8 G A 18: 4,333,965 R376C probably damaging Het
Map6 A T 7: 99,269,195 T189S possibly damaging Het
Mms22l T A 4: 24,505,357 S206T probably damaging Het
N4bp1 A G 8: 86,851,709 L676S probably damaging Het
Ociad2 C T 5: 73,323,830 C72Y probably damaging Het
Olfr1490 T A 19: 13,654,982 C184* probably null Het
Olfr672 A T 7: 104,995,984 F307I probably benign Het
Pcdhb6 G T 18: 37,336,140 V21L probably damaging Het
Pogk G A 1: 166,403,512 T82I probably damaging Het
Prkcsh A G 9: 22,011,252 E283G probably null Het
Prkd3 C T 17: 78,985,304 R113H probably damaging Het
Rabgef1 T C 5: 130,212,120 probably null Het
Rec8 T C 14: 55,622,497 I234T possibly damaging Het
Sim1 A T 10: 50,981,336 H394L probably benign Het
Thy1 A G 9: 44,046,731 E52G probably damaging Het
Trav14n-3 A T 14: 53,370,086 I4F probably damaging Het
Trim15 T C 17: 36,866,876 T76A possibly damaging Het
Ttn A G 2: 76,768,801 I19288T probably damaging Het
Vmn1r6 C T 6: 57,002,935 T172I probably damaging Het
Vmn2r52 A T 7: 10,159,178 L678Q probably damaging Het
Vpreb1 T C 16: 16,868,804 H74R probably benign Het
Yeats4 T C 10: 117,220,368 I100V probably benign Het
Zfp36 C A 7: 28,378,256 A76S probably benign Het
Other mutations in Nkx6-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Nkx6-2 APN 7 139581685 missense probably damaging 1.00
R4702:Nkx6-2 UTSW 7 139581540 missense probably damaging 1.00
R4944:Nkx6-2 UTSW 7 139581570 missense possibly damaging 0.80
R6020:Nkx6-2 UTSW 7 139581567 missense possibly damaging 0.80
R7156:Nkx6-2 UTSW 7 139582129 splice site probably null
R7430:Nkx6-2 UTSW 7 139582000 missense probably damaging 1.00
R7469:Nkx6-2 UTSW 7 139581639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCAGCGCGAAGATCTG -3'
(R):5'- ATGAAGACGTCGCTGTTCCC -3'

Sequencing Primer
(F):5'- ATCTGCTGGCCGGAGAAAGTC -3'
(R):5'- ACTCCGCACGGCATCAG -3'
Posted On2015-09-03