Incidental Mutation 'R0212:Cd8a'
ID33533
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene NameCD8 antigen, alpha chain
SynonymsLy-35, Lyt-2, Ly-B, Ly-2
MMRRC Submission 038463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R0212 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71373427-71379173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71373649 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 33 (E33K)
Ref Sequence ENSEMBL: ENSMUSP00000068123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
PDB Structure
MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION]
CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION]
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000066747
AA Change: E33K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: E33K

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172321
AA Change: E33K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: E33K

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205054
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen acts as a coreceptor with the T-cell receptor on the T lymphocyte to recognize antigens displayed by an antigen presenting cell in the context of class I MHC molecules. The coreceptor functions as either a homodimer composed of two alpha chains or as a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 alpha chain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,848,910 probably null Het
Adat1 T A 8: 111,987,208 D113V possibly damaging Het
Arhgap40 T G 2: 158,550,575 L656V probably damaging Het
Atg2a T C 19: 6,246,554 I330T probably damaging Het
Cad A G 5: 31,078,110 D2137G probably damaging Het
Cemip C A 7: 83,973,190 G594C probably damaging Het
Chd6 T A 2: 161,052,847 D31V probably damaging Het
Cmpk1 A T 4: 114,965,019 M111K possibly damaging Het
Crispld2 T G 8: 120,010,631 H40Q probably benign Het
Depdc5 A G 5: 32,912,242 T441A probably benign Het
Dpm1 T C 2: 168,227,494 N5S probably benign Het
Ercc4 A G 16: 13,123,332 probably null Het
Fam83f A T 15: 80,690,578 M229L probably benign Het
Fgd5 A T 6: 91,988,208 D474V probably damaging Het
Fgf21 G T 7: 45,614,102 P184Q probably benign Het
Fry A T 5: 150,496,397 D1008V probably damaging Het
Gjd2 T C 2: 114,011,472 T175A probably benign Het
Gphn C T 12: 78,637,552 T577I probably damaging Het
Ifi207 A T 1: 173,736,398 N18K possibly damaging Het
Ifne T C 4: 88,879,735 R149G possibly damaging Het
Ift80 A T 3: 68,940,173 L330H probably benign Het
Inpp4b A T 8: 81,770,917 H122L probably benign Het
Inpp5e T C 2: 26,408,340 probably null Het
Ism1 T C 2: 139,740,257 L163S probably benign Het
Itga11 T A 9: 62,745,969 V375E probably benign Het
Itpr3 T G 17: 27,089,319 F306V probably damaging Het
Kif19a A T 11: 114,784,910 I403F possibly damaging Het
Klf12 A T 14: 100,022,862 S144T probably benign Het
Lyst C T 13: 13,635,985 H747Y possibly damaging Het
Mccc2 A G 13: 99,954,655 Y445H probably benign Het
Mei1 G A 15: 82,095,931 probably null Het
Metap2 T A 10: 93,861,380 K479N probably damaging Het
Mief2 A T 11: 60,730,667 D62V probably damaging Het
Mtrf1 A G 14: 79,419,279 D407G probably benign Het
Myo3a A G 2: 22,291,848 R210G probably damaging Het
Nkx2-2 T C 2: 147,184,170 H216R probably damaging Het
Nos1 A G 5: 117,910,212 E694G possibly damaging Het
Nptn A T 9: 58,627,881 Y103F probably benign Het
Nrxn1 A G 17: 90,362,758 probably null Het
Numbl T C 7: 27,280,759 S389P probably damaging Het
Olfr1155 A G 2: 87,943,091 F179S probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr152 C T 2: 87,783,482 P314L unknown Het
Olfr357 A T 2: 36,997,323 D171V probably damaging Het
Olfr357 T A 2: 36,997,632 V274E possibly damaging Het
Olfr44 C A 9: 39,485,088 S55I probably damaging Het
Olfr975 A G 9: 39,949,940 V277A probably benign Het
Osm T G 11: 4,238,465 S31A probably benign Het
Paqr4 T C 17: 23,738,320 M70V probably benign Het
Pikfyve T A 1: 65,262,905 Y1607N probably benign Het
Plec A C 15: 76,191,305 Y402* probably null Het
Polq A G 16: 37,066,854 K1631E probably damaging Het
Pou6f1 A G 15: 100,580,815 V129A possibly damaging Het
Prm2 A G 16: 10,791,599 probably benign Het
Prtn3 A G 10: 79,881,137 Y112C probably damaging Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rps6ka5 A T 12: 100,553,169 probably null Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Slc10a1 A C 12: 80,967,712 L78R possibly damaging Het
Slc26a5 A T 5: 21,823,549 Y340* probably null Het
Sptbn2 T C 19: 4,746,942 probably null Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tmem131l A T 3: 83,913,268 S1226T probably benign Het
Togaram2 C T 17: 71,724,983 L866F probably damaging Het
Txndc17 A G 11: 72,207,732 T37A probably benign Het
Vmn2r105 C A 17: 20,208,565 V750F possibly damaging Het
Vmn2r54 T A 7: 12,632,497 Y170F probably benign Het
Wrnip1 T C 13: 32,821,906 V577A probably benign Het
Zc3h7b A G 15: 81,776,328 T226A probably benign Het
Zfp948 T C 17: 21,588,160 I538T probably benign Het
Zzef1 A G 11: 72,873,910 E1401G possibly damaging Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71373707 missense probably benign 0.04
IGL02342:Cd8a APN 6 71373739 missense probably damaging 1.00
alfalfa UTSW 6 71373728 missense probably damaging 0.99
wenzhou UTSW 6 71373872 missense probably benign 0.02
R1158:Cd8a UTSW 6 71373728 missense probably damaging 0.99
R1813:Cd8a UTSW 6 71373963 missense possibly damaging 0.47
R4541:Cd8a UTSW 6 71373872 missense probably benign 0.02
R5836:Cd8a UTSW 6 71373791 missense possibly damaging 0.48
R6390:Cd8a UTSW 6 71373929 missense probably damaging 0.97
R6889:Cd8a UTSW 6 71374562 missense probably damaging 1.00
Z1088:Cd8a UTSW 6 71373686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCCCTAAAAGGTGGTTGACACTC -3'
(R):5'- CTCATGGCAGAAAACAGTTTCGACG -3'

Sequencing Primer
(F):5'- AGGAAATCAGCTCTGTCTGC -3'
(R):5'- ACAGTTTCGACGAATTCAGC -3'
Posted On2013-05-09