Incidental Mutation 'R0212:Cd8a'
ID33533
Institutional Source Beutler Lab
Gene Symbol Cd8a
Ensembl Gene ENSMUSG00000053977
Gene NameCD8 antigen, alpha chain
SynonymsLy-35, Lyt-2, Ly-B, Ly-2
MMRRC Submission 038463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R0212 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71373427-71379171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71373649 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 33 (E33K)
Ref Sequence ENSEMBL: ENSMUSP00000068123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066747] [ENSMUST00000172321]
PDB Structure
MURINE CD8AA ECTODOMAIN FRAGMENT IN COMPLEX WITH H-2KB/VSV8 [X-RAY DIFFRACTION]
The Crystal Structure of a TL/CD8aa Complex at 2.1A resolution:Implications for Memory T cell Generation, Co-receptor Preference and Affinity [X-RAY DIFFRACTION]
CD8alpha-alpha in complex with YTS 105.18 Fab [X-RAY DIFFRACTION]
Crystal structure of a CD8ab heterodimer [X-RAY DIFFRACTION]
Crystal structure of CD8alpha-beta in complex with YTS 156.7 FAB [X-RAY DIFFRACTION]
Crystal structure of the CD8 alpha beta/H-2Dd complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000066747
AA Change: E33K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000068123
Gene: ENSMUSG00000053977
AA Change: E33K

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172321
AA Change: E33K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131873
Gene: ENSMUSG00000053977
AA Change: E33K

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
IG 38 148 1.46e-5 SMART
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205054
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Animals homozygous for a mutation in this gene lack CD8+CD4- cytotoxic T cells in the thymus and spleen and do not mount a cytotoxic response to alloantigens.
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,848,910 probably null Het
Adat1 T A 8: 111,987,208 D113V possibly damaging Het
AI607873 A T 1: 173,736,398 N18K possibly damaging Het
Arhgap40 T G 2: 158,550,575 L659V probably damaging Het
Atg2a T C 19: 6,246,554 I330T probably damaging Het
Cad A G 5: 31,078,110 D2198G probably damaging Het
Cemip C A 7: 83,973,190 G594C probably damaging Het
Chd6 T A 2: 161,052,847 D31V probably damaging Het
Cmpk1 A T 4: 114,965,019 M111K probably benign Het
Crispld2 T G 8: 120,010,631 H40Q probably benign Het
D930015E06Rik A T 3: 83,913,268 S1226T probably benign Het
Depdc5 A G 5: 32,912,242 T441A probably benign Het
Dpm1 T C 2: 168,227,494 N5S probably benign Het
Ercc4 A G 16: 13,123,332 probably null Het
Fam179a C T 17: 71,724,983 L886F probably damaging Het
Fam83f A T 15: 80,690,578 M229L probably benign Het
Fgd5 A T 6: 91,988,208 D474V probably damaging Het
Fgf21 G T 7: 45,614,102 P184Q probably benign Het
Fry A T 5: 150,496,397 D1008V probably damaging Het
Gjd2 T C 2: 114,011,472 T175A probably benign Het
Gphn C T 12: 78,637,552 T577I probably damaging Het
Ifne T C 4: 88,879,735 R149G possibly damaging Het
Ift80 A T 3: 68,940,173 L330H probably benign Het
Inpp4b A T 8: 81,770,917 H122L probably benign Het
Inpp5e T C 2: 26,408,340 K83R probably benign Het
Ism1 T C 2: 139,740,257 L163S probably benign Het
Itga11 T A 9: 62,745,969 V375E probably benign Het
Itpr3 T G 17: 27,089,319 F306V probably damaging Het
Kif19a A T 11: 114,784,910 I403F possibly damaging Het
Klf12 A T 14: 100,022,862 S144T probably benign Het
Lyst C T 13: 13,635,985 H747Y possibly damaging Het
Mccc2 A G 13: 99,954,655 Y445H probably benign Het
Mei1 G A 15: 82,095,931 probably null Het
Metap2 T A 10: 93,861,380 K479N probably damaging Het
Mief2 A T 11: 60,730,667 D62V probably damaging Het
Mtrf1 A G 14: 79,419,279 D407G probably benign Het
Myo3a A G 2: 22,291,848 R218G probably damaging Het
Nkx2-2 T C 2: 147,184,170 H216R probably damaging Het
Nos1 A G 5: 117,910,212 E694G possibly damaging Het
Nptn A T 9: 58,627,881 Y103F probably benign Het
Nrxn1 A G 17: 90,362,758 V167A probably null Het
Numbl T C 7: 27,280,759 S389P probably damaging Het
Olfr1155 A G 2: 87,943,091 F179S probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr152 C T 2: 87,783,482 P316L unknown Het
Olfr357 A T 2: 36,997,323 D171V probably damaging Het
Olfr357 T A 2: 36,997,632 V274E possibly damaging Het
Olfr44 C A 9: 39,485,088 S55I probably damaging Het
Olfr975 A G 9: 39,949,940 V277A probably benign Het
Osm T G 11: 4,238,465 S31A probably benign Het
Paqr4 T C 17: 23,738,320 M70V probably benign Het
Pikfyve T A 1: 65,262,905 Y1607N probably benign Het
Plec A C 15: 76,191,305 Y402* probably null Het
Polq A G 16: 37,066,854 K1631E probably damaging Het
Pou6f1 A G 15: 100,580,815 V129A possibly damaging Het
Prm2 A G 16: 10,791,599 C99R unknown Het
Prtn3 A G 10: 79,881,137 Y112C probably damaging Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rps6ka5 A T 12: 100,553,169 probably null Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Slc10a1 A C 12: 80,967,712 L78R possibly damaging Het
Slc26a5 A T 5: 21,823,549 Y340* probably null Het
Sptbn2 T C 19: 4,746,942 probably null Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Txndc17 A G 11: 72,207,732 T37A probably benign Het
Vmn2r105 C A 17: 20,208,565 V750F possibly damaging Het
Vmn2r54 T A 7: 12,632,497 Y170F probably benign Het
Wrnip1 T C 13: 32,821,906 V577A probably benign Het
Zc3h7b A G 15: 81,776,328 T226A probably benign Het
Zfp948 T C 17: 21,588,160 I538T probably benign Het
Zzef1 A G 11: 72,873,910 E1401G possibly damaging Het
Other mutations in Cd8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Cd8a APN 6 71373707 missense probably benign 0.04
IGL02342:Cd8a APN 6 71373739 missense probably damaging 1.00
alfalfa UTSW 6 71373728 missense probably damaging 0.99
wenzhou UTSW 6 71373872 missense probably benign 0.02
R1158:Cd8a UTSW 6 71373728 missense probably damaging 0.99
R1813:Cd8a UTSW 6 71373963 missense possibly damaging 0.47
R4541:Cd8a UTSW 6 71373872 missense probably benign 0.02
R5836:Cd8a UTSW 6 71373791 missense possibly damaging 0.48
R6390:Cd8a UTSW 6 71373929 missense probably damaging 0.97
Z1088:Cd8a UTSW 6 71373686 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCCCCTAAAAGGTGGTTGACACTC -3'
(R):5'- CTCATGGCAGAAAACAGTTTCGACG -3'

Sequencing Primer
(F):5'- AGGAAATCAGCTCTGTCTGC -3'
(R):5'- ACAGTTTCGACGAATTCAGC -3'
Posted OnMay 09, 2013