Incidental Mutation 'R0212:Fam83f'
ID33569
Institutional Source Beutler Lab
Gene Symbol Fam83f
Ensembl Gene ENSMUSG00000022408
Gene Namefamily with sequence similarity 83, member F
Synonyms
MMRRC Submission 038463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0212 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location80671847-80700425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80690578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 229 (M229L)
Ref Sequence ENSEMBL: ENSMUSP00000023044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023044]
Predicted Effect probably benign
Transcript: ENSMUST00000023044
AA Change: M229L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023044
Gene: ENSMUSG00000022408
AA Change: M229L

DomainStartEndE-ValueType
Pfam:DUF1669 15 291 1.5e-111 PFAM
Pfam:PLDc_2 148 286 6.4e-12 PFAM
low complexity region 346 360 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230612
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,848,910 probably null Het
Adat1 T A 8: 111,987,208 D113V possibly damaging Het
Arhgap40 T G 2: 158,550,575 L656V probably damaging Het
Atg2a T C 19: 6,246,554 I330T probably damaging Het
Cad A G 5: 31,078,110 D2137G probably damaging Het
Cd8a G A 6: 71,373,649 E33K probably benign Het
Cemip C A 7: 83,973,190 G594C probably damaging Het
Chd6 T A 2: 161,052,847 D31V probably damaging Het
Cmpk1 A T 4: 114,965,019 M111K possibly damaging Het
Crispld2 T G 8: 120,010,631 H40Q probably benign Het
Depdc5 A G 5: 32,912,242 T441A probably benign Het
Dpm1 T C 2: 168,227,494 N5S probably benign Het
Ercc4 A G 16: 13,123,332 probably null Het
Fgd5 A T 6: 91,988,208 D474V probably damaging Het
Fgf21 G T 7: 45,614,102 P184Q probably benign Het
Fry A T 5: 150,496,397 D1008V probably damaging Het
Gjd2 T C 2: 114,011,472 T175A probably benign Het
Gphn C T 12: 78,637,552 T577I probably damaging Het
Ifi207 A T 1: 173,736,398 N18K possibly damaging Het
Ifne T C 4: 88,879,735 R149G possibly damaging Het
Ift80 A T 3: 68,940,173 L330H probably benign Het
Inpp4b A T 8: 81,770,917 H122L probably benign Het
Inpp5e T C 2: 26,408,340 probably null Het
Ism1 T C 2: 139,740,257 L163S probably benign Het
Itga11 T A 9: 62,745,969 V375E probably benign Het
Itpr3 T G 17: 27,089,319 F306V probably damaging Het
Kif19a A T 11: 114,784,910 I403F possibly damaging Het
Klf12 A T 14: 100,022,862 S144T probably benign Het
Lyst C T 13: 13,635,985 H747Y possibly damaging Het
Mccc2 A G 13: 99,954,655 Y445H probably benign Het
Mei1 G A 15: 82,095,931 probably null Het
Metap2 T A 10: 93,861,380 K479N probably damaging Het
Mief2 A T 11: 60,730,667 D62V probably damaging Het
Mtrf1 A G 14: 79,419,279 D407G probably benign Het
Myo3a A G 2: 22,291,848 R210G probably damaging Het
Nkx2-2 T C 2: 147,184,170 H216R probably damaging Het
Nos1 A G 5: 117,910,212 E694G possibly damaging Het
Nptn A T 9: 58,627,881 Y103F probably benign Het
Nrxn1 A G 17: 90,362,758 probably benign Het
Numbl T C 7: 27,280,759 S389P probably damaging Het
Olfr1155 A G 2: 87,943,091 F179S probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr152 C T 2: 87,783,482 P314L unknown Het
Olfr357 A T 2: 36,997,323 D171V probably damaging Het
Olfr357 T A 2: 36,997,632 V274E possibly damaging Het
Olfr44 C A 9: 39,485,088 S55I probably damaging Het
Olfr975 A G 9: 39,949,940 V277A probably benign Het
Osm T G 11: 4,238,465 S31A probably benign Het
Paqr4 T C 17: 23,738,320 M70V probably benign Het
Pikfyve T A 1: 65,262,905 Y1607N probably benign Het
Plec A C 15: 76,191,305 Y402* probably null Het
Polq A G 16: 37,066,854 K1631E probably damaging Het
Pou6f1 A G 15: 100,580,815 V129A possibly damaging Het
Prm2 A G 16: 10,791,599 probably benign Het
Prtn3 A G 10: 79,881,137 Y112C probably damaging Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rps6ka5 A T 12: 100,553,169 probably null Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Slc10a1 A C 12: 80,967,712 L78R possibly damaging Het
Slc26a5 A T 5: 21,823,549 Y340* probably null Het
Sptbn2 T C 19: 4,746,942 probably null Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tmem131l A T 3: 83,913,268 S1226T probably benign Het
Togaram2 C T 17: 71,724,983 L866F probably damaging Het
Txndc17 A G 11: 72,207,732 T37A probably benign Het
Vmn2r105 C A 17: 20,208,565 V750F possibly damaging Het
Vmn2r54 T A 7: 12,632,497 Y170F probably benign Het
Wrnip1 T C 13: 32,821,906 V577A probably benign Het
Zc3h7b A G 15: 81,776,328 T226A probably benign Het
Zfp948 T C 17: 21,588,160 I538T probably benign Het
Zzef1 A G 11: 72,873,910 E1401G possibly damaging Het
Other mutations in Fam83f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Fam83f APN 15 80672149 missense probably benign
R0347:Fam83f UTSW 15 80672257 missense probably damaging 1.00
R0976:Fam83f UTSW 15 80692084 missense probably damaging 1.00
R1724:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1725:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1741:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1796:Fam83f UTSW 15 80690082 missense possibly damaging 0.80
R1870:Fam83f UTSW 15 80689912 splice site probably benign
R1899:Fam83f UTSW 15 80692080 missense probably damaging 1.00
R2022:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2114:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2115:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R4090:Fam83f UTSW 15 80692192 missense possibly damaging 0.85
R4865:Fam83f UTSW 15 80692449 missense probably damaging 1.00
R4893:Fam83f UTSW 15 80691955 missense probably damaging 1.00
R5206:Fam83f UTSW 15 80692054 missense possibly damaging 0.86
R5739:Fam83f UTSW 15 80692005 missense probably damaging 1.00
R6468:Fam83f UTSW 15 80692111 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCCAAGCCTCAGGAACTTGTAAC -3'
(R):5'- TGCGATCAGGACACAGACAATGAC -3'

Sequencing Primer
(F):5'- GAACCATTGACTTCACTGTCAGG -3'
(R):5'- GACACAGACAATGACTCTTAAAAATC -3'
Posted On2013-05-09