Incidental Mutation 'R0218:Zfp518a'
ID33696
Institutional Source Beutler Lab
Gene Symbol Zfp518a
Ensembl Gene ENSMUSG00000049164
Gene Namezinc finger protein 518A
Synonyms6330417C12Rik, 2810401C22Rik, Zfp518
MMRRC Submission 038467-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R0218 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location40894705-40917947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40912628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 334 (T334A)
Ref Sequence ENSEMBL: ENSMUSP00000055956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050092]
Predicted Effect probably benign
Transcript: ENSMUST00000050092
AA Change: T334A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055956
Gene: ENSMUSG00000049164
AA Change: T334A

DomainStartEndE-ValueType
ZnF_C2H2 121 146 1.38e2 SMART
ZnF_C2H2 152 174 4.98e-1 SMART
ZnF_C2H2 179 203 6.75e0 SMART
ZnF_C2H2 209 231 4.34e-1 SMART
ZnF_C2H2 236 258 1.33e-1 SMART
ZnF_C2H2 264 287 9.44e-2 SMART
low complexity region 308 319 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
low complexity region 544 563 N/A INTRINSIC
low complexity region 671 680 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1147 1164 N/A INTRINSIC
low complexity region 1417 1424 N/A INTRINSIC
ZnF_C2H2 1444 1466 1.33e1 SMART
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc finger protein family. The encoded protein contains five zinc fingers and is likely a nuclear transcriptional regulator. Numerous transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,116,437 Y10* probably null Het
Adgrv1 C T 13: 81,106,898 probably null Het
Ccdc110 A G 8: 45,934,724 probably benign Het
Cd200r1 T A 16: 44,788,743 probably benign Het
Cdkl1 A T 12: 69,790,035 D40E probably benign Het
Cdx1 A G 18: 61,020,364 probably benign Het
Cenpp T A 13: 49,647,632 K103N possibly damaging Het
Cep162 A G 9: 87,211,809 Y839H possibly damaging Het
Chac1 T A 2: 119,353,460 L181* probably null Het
Ciapin1 G T 8: 94,828,310 Q173K probably damaging Het
Dgcr2 A G 16: 17,849,786 C270R probably damaging Het
Dlc1 A G 8: 36,850,229 S431P probably benign Het
Efcab12 T C 6: 115,814,650 probably benign Het
Ehbp1 A T 11: 22,231,992 probably benign Het
Enpp3 A T 10: 24,776,869 V730D possibly damaging Het
Fam174b A G 7: 73,740,764 T88A probably benign Het
Fancl A G 11: 26,471,337 K364E probably benign Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Galc A G 12: 98,222,647 Y402H probably damaging Het
Gga2 T C 7: 121,998,900 N324D possibly damaging Het
Gm13103 A G 4: 143,851,831 I220M probably damaging Het
Gm5346 T G 8: 43,626,440 Q249P probably benign Het
Gpr1 T A 1: 63,183,531 N182Y probably benign Het
Hc G T 2: 35,028,074 F732L probably damaging Het
Heca T C 10: 17,915,715 M198V probably benign Het
Herc6 C A 6: 57,619,601 H509N probably benign Het
Irf2bpl A T 12: 86,882,624 M425K probably benign Het
Mael C T 1: 166,238,590 G26D probably damaging Het
Map1a A G 2: 121,305,425 T2241A probably benign Het
Mcc C G 18: 44,519,516 probably benign Het
Mdga2 A G 12: 66,655,120 S505P probably damaging Het
Mdm1 A G 10: 118,156,878 probably benign Het
Mex3b A T 7: 82,869,104 E209V probably damaging Het
Mrgprx3-ps T C 7: 47,309,406 E279G possibly damaging Het
Nfe2l1 A T 11: 96,827,613 L32Q probably damaging Het
Npas1 C T 7: 16,461,893 V285I probably benign Het
Olfr1499 T C 19: 13,814,978 N204S probably benign Het
Olfr187 C T 16: 59,036,093 V215I probably benign Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Osr1 A G 12: 9,579,639 T171A probably benign Het
Ppp3cb A T 14: 20,523,976 C265S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Simc1 T C 13: 54,526,604 Y922H probably damaging Het
Slc25a39 A G 11: 102,406,230 F56L probably benign Het
Smg8 A G 11: 87,086,122 L211P probably damaging Het
Sncaip A G 18: 52,907,328 S805G probably benign Het
Sra1 T C 18: 36,676,609 probably benign Het
Tas2r104 T G 6: 131,685,092 D218A probably damaging Het
Unc45b A G 11: 82,911,860 probably benign Het
Unc79 A G 12: 103,108,781 probably null Het
Washc2 T A 6: 116,248,046 L785* probably null Het
Zfp30 A G 7: 29,793,638 E439G probably damaging Het
Other mutations in Zfp518a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Zfp518a APN 19 40913470 missense probably damaging 0.99
IGL00647:Zfp518a APN 19 40914686 missense probably damaging 1.00
IGL01468:Zfp518a APN 19 40916031 missense probably benign 0.25
IGL02079:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02080:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02437:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02466:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02470:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02471:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02472:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02500:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02537:Zfp518a APN 19 40915430 missense probably benign 0.05
IGL02546:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02547:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02561:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02568:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02583:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02584:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02586:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02589:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02614:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02732:Zfp518a APN 19 40914617 missense probably damaging 1.00
IGL02961:Zfp518a APN 19 40915018 missense probably benign 0.44
IGL02985:Zfp518a APN 19 40913667 missense possibly damaging 0.92
R0137:Zfp518a UTSW 19 40915866 missense probably damaging 1.00
R0367:Zfp518a UTSW 19 40912221 missense probably damaging 1.00
R0575:Zfp518a UTSW 19 40912315 missense probably damaging 1.00
R1418:Zfp518a UTSW 19 40914359 missense probably damaging 1.00
R1795:Zfp518a UTSW 19 40915556 missense probably benign 0.05
R1965:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R2076:Zfp518a UTSW 19 40914327 missense probably damaging 1.00
R3796:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3799:Zfp518a UTSW 19 40915310 missense probably damaging 1.00
R3807:Zfp518a UTSW 19 40914797 missense possibly damaging 0.90
R3904:Zfp518a UTSW 19 40914920 nonsense probably null
R3959:Zfp518a UTSW 19 40912698 missense probably damaging 1.00
R4630:Zfp518a UTSW 19 40912979 nonsense probably null
R4662:Zfp518a UTSW 19 40911860 missense probably benign 0.01
R4844:Zfp518a UTSW 19 40914896 missense probably damaging 0.99
R4911:Zfp518a UTSW 19 40915528 missense probably benign 0.04
R4934:Zfp518a UTSW 19 40914263 missense probably benign 0.01
R4964:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R4966:Zfp518a UTSW 19 40915851 missense possibly damaging 0.94
R5373:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5374:Zfp518a UTSW 19 40913510 missense probably benign 0.00
R5378:Zfp518a UTSW 19 40915856 missense probably damaging 1.00
R5509:Zfp518a UTSW 19 40915401 missense possibly damaging 0.60
R5891:Zfp518a UTSW 19 40912433 missense probably damaging 1.00
R6187:Zfp518a UTSW 19 40915446 missense probably benign 0.03
R6259:Zfp518a UTSW 19 40912781 missense probably benign 0.01
R6260:Zfp518a UTSW 19 40914123 missense probably benign 0.00
R6763:Zfp518a UTSW 19 40913748 missense probably damaging 1.00
X0028:Zfp518a UTSW 19 40914933 missense possibly damaging 0.61
X0065:Zfp518a UTSW 19 40914182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGCACCTTCGTGTCCACTCTG -3'
(R):5'- CGACGGGCTTATCACCATTCTCAC -3'

Sequencing Primer
(F):5'- GTGCCATTCATAAAGACCAACTTATC -3'
(R):5'- GCTTATCACCATTCTCACAGTGC -3'
Posted On2013-05-09