Incidental Mutation 'R0219:Kcp'
ID33720
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0219 (G1)
Quality Score139
Status Validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29495785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 773 (R773W)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000159479]
Predicted Effect probably damaging
Transcript: ENSMUST00000078112
AA Change: R773W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: R773W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091391
AA Change: R773W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: R773W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101614
AA Change: R773W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: R773W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159479
AA Change: R44W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124771
Gene: ENSMUSG00000059022
AA Change: R44W

DomainStartEndE-ValueType
VWC 1 51 4.56e-1 SMART
VWC 54 110 1.98e-8 SMART
VWC 113 169 1.35e-1 SMART
VWC 172 228 5.77e-10 SMART
VWC 231 286 1.21e-3 SMART
VWC 289 353 6.53e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160181
SMART Domains Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 18 74 1.24e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162959
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utp20 T C 10: 88,764,675 E1987G probably damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6020:Kcp UTSW 6 29502864 missense probably benign 0.03
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense not run
Predicted Primers PCR Primer
(F):5'- GTTATTTGCCCAAGTTCACACACCC -3'
(R):5'- AGTCACCGTGATCTCCCCAGTC -3'

Sequencing Primer
(F):5'- ctgctgcctctgcctac -3'
(R):5'- GTGATCTCCCCAGTCACTCC -3'
Posted On2013-05-09