Incidental Mutation 'R0219:Utp20'
ID33737
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 038468-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R0219 (G1)
Quality Score218
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88764675 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1987 (E1987G)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470] [ENSMUST00000218967] [ENSMUST00000220188]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: E1987G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: E1987G

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218967
AA Change: E59G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000220188
AA Change: E59G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.3%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,886,150 probably benign Het
Acacb T A 5: 114,232,944 M1749K possibly damaging Het
Aff1 GCTCTCTCTC GCTCTCTCTCTC 5: 103,811,040 probably benign Het
Ankle2 C T 5: 110,251,645 R624* probably null Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Brca2 A G 5: 150,523,175 probably benign Het
Ccdc116 T A 16: 17,141,612 R404S possibly damaging Het
Ccdc171 A G 4: 83,696,441 probably benign Het
Ccdc80 A G 16: 45,096,483 K534R probably damaging Het
Ccna1 T C 3: 55,050,927 I112V probably benign Het
Cdhr1 A C 14: 37,079,601 L795R possibly damaging Het
Cilp C A 9: 65,269,590 L43I possibly damaging Het
Dclk2 T C 3: 86,813,669 probably benign Het
Ddx59 C A 1: 136,432,309 probably benign Het
Dgkd T C 1: 87,938,274 probably benign Het
Dicer1 A G 12: 104,692,125 probably null Het
Dst T G 1: 34,303,478 S5030A probably damaging Het
Dysf G A 6: 84,129,461 probably benign Het
Farp1 C A 14: 121,243,600 P471Q possibly damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fcer1g A G 1: 171,231,226 V31A possibly damaging Het
Glb1l2 A G 9: 26,806,322 V21A probably benign Het
Gm9912 T C 3: 149,185,495 I1V unknown Het
Guf1 G A 5: 69,559,586 A164T probably damaging Het
Hbb-bs T C 7: 103,826,669 H147R possibly damaging Het
Hnrnpr T A 4: 136,339,163 probably benign Het
Iglon5 A T 7: 43,476,837 V214E probably damaging Het
Isx C A 8: 74,889,961 probably null Het
Kank4 T C 4: 98,778,465 N582D probably benign Het
Kcp T A 6: 29,495,785 R773W probably damaging Het
Kdm4c T C 4: 74,373,620 C825R probably damaging Het
Krt25 G A 11: 99,318,059 T315M probably benign Het
Lrp5 A T 19: 3,597,349 S1298T probably damaging Het
Map3k10 T C 7: 27,656,731 D921G probably damaging Het
Mrgprx1 C A 7: 48,021,546 W151L probably damaging Het
Mylk3 T A 8: 85,355,244 D375V probably damaging Het
Nav3 C T 10: 109,866,930 probably null Het
Ncan A G 8: 70,115,334 S43P probably benign Het
Necab3 G T 2: 154,546,093 Q292K probably benign Het
Nptx2 T C 5: 144,548,140 S148P probably damaging Het
Olfr414 G A 1: 174,430,466 V13I probably benign Het
Olfr520 A T 7: 99,735,928 I262L probably benign Het
Pde6a A G 18: 61,285,935 E794G possibly damaging Het
Pus7 T C 5: 23,775,966 Y133C possibly damaging Het
Rad21l A G 2: 151,654,588 probably benign Het
Rptor A T 11: 119,821,777 probably benign Het
Sart1 C A 19: 5,388,396 A78S probably benign Het
Shkbp1 T C 7: 27,352,061 E191G probably benign Het
Slc6a18 A T 13: 73,674,632 probably null Het
Stxbp5 T C 10: 9,770,528 T147A probably benign Het
Sv2b A G 7: 75,157,267 probably null Het
Syne2 A T 12: 76,042,004 K5045N probably damaging Het
Tmem174 A C 13: 98,636,839 M161R possibly damaging Het
Tmprss7 A G 16: 45,656,457 V814A probably damaging Het
Togaram2 T C 17: 71,714,230 probably benign Het
Tpr T C 1: 150,443,258 probably null Het
Ttn T C 2: 76,900,228 probably benign Het
Ubr4 T A 4: 139,430,257 L2375Q possibly damaging Het
Utrn T C 10: 12,684,451 T1365A probably damaging Het
Vmn2r116 T A 17: 23,386,098 Y128* probably null Het
Vmn2r5 A G 3: 64,504,313 V278A probably damaging Het
Vps13d C T 4: 145,105,909 S2809N probably benign Het
Zfp212 G A 6: 47,926,685 R68H probably damaging Het
Zfp442 A T 2: 150,411,240 L33Q probably damaging Het
Zfp629 T C 7: 127,612,083 S185G probably damaging Het
Zfp738 A G 13: 67,683,389 probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3547:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTACACGGTACTCGTTTGCTC -3'
(R):5'- GGCAATGCACGTCCACGTTTTG -3'

Sequencing Primer
(F):5'- GTTTGCTCCTTTAGCACAGAAG -3'
(R):5'- ACGAGATCGTGTATATCTTAGCC -3'
Posted On2013-05-09