Incidental Mutation 'R0220:Cyp3a59'
ID33781
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0220 (G1)
Quality Score141
Status Not validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146098270 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 253 (V253I)
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably benign
Transcript: ENSMUST00000035571
AA Change: V253I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292
AA Change: V253I

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Dennd4a A C 9: 64,852,445 E277D probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4013:Cyp3a59 UTSW 5 146079383 missense probably benign 0.01
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5627:Cyp3a59 UTSW 5 146112854 missense probably benign 0.00
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R6790:Cyp3a59 UTSW 5 146096333 missense probably benign
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
R7222:Cyp3a59 UTSW 5 146096575 critical splice acceptor site probably null
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGTACCGagcccatttagtattgctct -3'
(R):5'- ACTGTGTGCATCATGACCAAACCC -3'

Sequencing Primer
(F):5'- caacctttctacccccacatc -3'
(R):5'- TGACCAAACCCTAAGAATCATGAC -3'
Posted On2013-05-09