Incidental Mutation 'R0220:Dennd4a'
ID33793
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission 038469-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R0220 (G1)
Quality Score197
Status Not validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64852445 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 277 (E277D)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect probably damaging
Transcript: ENSMUST00000038890
AA Change: E277D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: E277D

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215025
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,148,420 probably null Het
Abcc5 A G 16: 20,369,102 V863A probably benign Het
Anxa6 A C 11: 54,981,762 probably null Het
Armc10 A G 5: 21,661,584 K296R probably benign Het
Arpc2 T A 1: 74,248,134 F38I probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Bcl6 T A 16: 23,966,219 H677L possibly damaging Het
Bcl7a G A 5: 123,351,919 V49I probably damaging Het
Ccnj T C 19: 40,844,810 L144P probably damaging Het
Cdh8 G T 8: 99,111,679 P510T probably benign Het
Cgnl1 C A 9: 71,724,943 K375N possibly damaging Het
Cubn C A 2: 13,356,709 R1695L probably damaging Het
Cyp3a59 G A 5: 146,098,270 V253I probably benign Het
Cyp4f13 A G 17: 32,929,502 I208T probably damaging Het
Depdc1a G A 3: 159,523,905 V625I probably benign Het
Dot1l A T 10: 80,785,858 D448V probably damaging Het
Efhc1 A G 1: 20,967,358 D253G probably damaging Het
Eme1 T A 11: 94,650,258 E246V probably null Het
Foxred1 A G 9: 35,209,453 L128P probably damaging Het
Gm14124 A T 2: 150,268,675 Q428H unknown Het
Gm4787 G T 12: 81,378,648 S245R probably damaging Het
Gm5141 T A 13: 62,774,457 K299N probably damaging Het
Greb1 C A 12: 16,682,286 R1558L probably damaging Het
Ip6k3 A T 17: 27,145,229 F282I probably damaging Het
Kdm2a T C 19: 4,324,919 D288G possibly damaging Het
Kdm4d A T 9: 14,463,122 V480E probably benign Het
Kif26a A T 12: 112,157,390 Q143L probably damaging Het
Klhl41 G A 2: 69,670,485 D97N probably benign Het
Krt34 C T 11: 100,038,693 probably benign Het
Lcn11 A T 2: 25,777,831 H77L probably benign Het
Megf6 G A 4: 154,258,215 R529H probably damaging Het
Mipol1 A G 12: 57,457,150 E368G probably damaging Het
Mtus1 A T 8: 40,994,572 M442K probably damaging Het
Naca T C 10: 128,043,386 probably benign Het
Nbea G A 3: 56,005,303 T1021I probably benign Het
Nfib A T 4: 82,296,776 V530E probably damaging Het
Nptx1 A G 11: 119,544,641 V283A probably damaging Het
Olfr1261 G T 2: 89,993,862 L156F probably benign Het
Olfr190 A T 16: 59,074,732 M116K probably damaging Het
Opn5 A G 17: 42,596,604 V127A probably benign Het
Pcgf6 A G 19: 47,040,090 V291A probably benign Het
Pilrb2 C A 5: 137,871,197 R47L probably benign Het
Prom2 A C 2: 127,541,107 S72A probably benign Het
Sema3e T C 5: 14,164,153 F144S possibly damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smarcc2 A T 10: 128,483,636 D798V probably benign Het
Taf5 T C 19: 47,080,560 S563P probably damaging Het
Topaz1 A G 9: 122,749,303 H426R possibly damaging Het
Tpgs1 T A 10: 79,675,437 C138S possibly damaging Het
Traf1 A T 2: 34,949,103 V70D probably benign Het
Ttn T C 2: 76,811,393 Y13453C probably damaging Het
Ubxn4 T A 1: 128,256,194 V97D possibly damaging Het
Ugt1a8 A T 1: 88,088,335 I157L probably benign Het
Vmn2r13 A T 5: 109,156,466 C700S probably damaging Het
Wee1 A T 7: 110,124,526 D216V probably benign Het
Zc3h4 T C 7: 16,429,273 Y533H unknown Het
Zfp81 A G 17: 33,336,724 I43T possibly damaging Het
Zfp963 A T 8: 69,743,493 Y103* probably null Het
Zfp963 A T 8: 69,743,495 Y103N probably benign Het
Zzef1 G T 11: 72,865,966 D1126Y probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 intron probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGCTTGCCCTTACAGAGAGA -3'
(R):5'- GCATGAGGTCCAGAGATGGAATAACGAT -3'

Sequencing Primer
(F):5'- tgcttagaccctccatttcc -3'
(R):5'- TGGAATAACGATACAGAAAAGTCAG -3'
Posted On2013-05-09