Incidental Mutation 'R0225:Wfdc8'
ID33836
Institutional Source Beutler Lab
Gene Symbol Wfdc8
Ensembl Gene ENSMUSG00000070533
Gene NameWAP four-disulfide core domain 8
SynonymsLOC277343
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0225 (G1)
Quality Score179
Status Validated
Chromosome2
Chromosomal Location164596458-164613626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164597185 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 426 (Y426H)
Ref Sequence ENSEMBL: ENSMUSP00000104963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094351] [ENSMUST00000103100] [ENSMUST00000109338] [ENSMUST00000109339]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083863
Predicted Effect probably benign
Transcript: ENSMUST00000094351
SMART Domains Protein: ENSMUSP00000091911
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103100
SMART Domains Protein: ENSMUSP00000099389
Gene: ENSMUSG00000017733

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WAP 32 73 3.09e-3 SMART
KU 75 128 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109338
SMART Domains Protein: ENSMUSP00000104962
Gene: ENSMUSG00000070533

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
WAP 229 272 1.84e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109339
AA Change: Y426H

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104963
Gene: ENSMUSG00000070533
AA Change: Y426H

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
WAP 79 123 1.88e-2 SMART
KU 125 178 8.81e-25 SMART
WAP 182 226 8.82e-6 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 384 393 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. The encoded protein contains a Kunitz-inhibitor domain, in addition to three WFDC domains. Most WFDC genes are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Wfdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Wfdc8 APN 2 164605780 missense probably damaging 1.00
IGL02012:Wfdc8 APN 2 164603150 splice site probably benign
IGL02831:Wfdc8 APN 2 164605765 critical splice donor site probably null
PIT4131001:Wfdc8 UTSW 2 164597776 missense possibly damaging 0.94
PIT4520001:Wfdc8 UTSW 2 164603303 missense probably benign 0.09
R0006:Wfdc8 UTSW 2 164599064 missense probably damaging 0.96
R0603:Wfdc8 UTSW 2 164603225 missense probably damaging 1.00
R1741:Wfdc8 UTSW 2 164608869 unclassified probably benign
R5484:Wfdc8 UTSW 2 164597729 missense probably benign 0.11
R5546:Wfdc8 UTSW 2 164597319 utr 3 prime probably benign
R5614:Wfdc8 UTSW 2 164603203 missense probably damaging 1.00
R5668:Wfdc8 UTSW 2 164597419 utr 3 prime probably benign
R6410:Wfdc8 UTSW 2 164597743 missense probably benign 0.10
R6869:Wfdc8 UTSW 2 164599092 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AAGATGTAGCCCGTTTCTGCTTCTC -3'
(R):5'- TGGACCAGATGCACATTGTGCC -3'

Sequencing Primer
(F):5'- tcccctccccctccctc -3'
(R):5'- CACATTGTGCCAGCGCC -3'
Posted On2013-05-09