Incidental Mutation 'R0225:Bicd1'
ID33850
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 038470-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0225 (G1)
Quality Score197
Status Validated
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149512950 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 387 (I387T)
Ref Sequence ENSEMBL: ENSMUSP00000133727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
Predicted Effect probably benign
Transcript: ENSMUST00000003544
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086829
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: I387T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: I387T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174886
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Col18a1 T C 10: 77,088,914 S14G possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
F11 T C 8: 45,249,077 T267A probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Gadd45b A G 10: 80,930,347 N11S probably benign Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Gm10647 A G 9: 66,798,495 probably benign Het
Gm10936 G A 10: 117,248,130 noncoding transcript Het
Gzmd A G 14: 56,129,704 W244R probably damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kat2b A G 17: 53,641,210 E336G probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif23 C G 9: 61,925,694 probably benign Het
Lgi3 A T 14: 70,532,821 I109L probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Olfr729 T G 14: 50,148,635 K80Q probably damaging Het
Olfr933 A G 9: 38,976,278 I201V probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rapgef2 A T 3: 79,104,105 S224R probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Skor2 A T 18: 76,859,098 I172F unknown Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
St14 T A 9: 31,108,284 probably null Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tbxa2r C A 10: 81,332,900 T141K possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Tyms A G 5: 30,063,258 I148T probably damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn1r58 A C 7: 5,410,866 S122A probably benign Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Wfdc8 A G 2: 164,597,185 Y426H probably benign Het
Zfp948 A T 17: 21,587,294 K249N probably damaging Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zyg11a G A 4: 108,204,641 T321I probably damaging Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGCTTTTCCCTGAAGTGATTCAGAC -3'
(R):5'- GGCTATGCCAGTCATCTTTTGCAAC -3'

Sequencing Primer
(F):5'- ATTCAGACATTGTCTTCTGTCATTAC -3'
(R):5'- GATGTCTTCTCAAGGTTTGTCAC -3'
Posted On2013-05-09