Incidental Mutation 'R0226:Ablim1'
ID33976
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission 038471-MU
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R0226 (G1)
Quality Score167
Status Validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57043870 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 556 (L556Q)
Ref Sequence ENSEMBL: ENSMUSP00000107184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably damaging
Transcript: ENSMUST00000079360
AA Change: L703Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: L703Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099294
AA Change: L496Q

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085
AA Change: L496Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000104902
AA Change: L387Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085
AA Change: L387Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111526
AA Change: L242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085
AA Change: L242Q

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111528
AA Change: L296Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085
AA Change: L296Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111529
AA Change: L268Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085
AA Change: L268Q

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111544
AA Change: L510Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085
AA Change: L510Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111546
AA Change: L543Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085
AA Change: L543Q

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111550
AA Change: L524Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085
AA Change: L524Q

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111555
AA Change: L619Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: L619Q

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111558
AA Change: L586Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085
AA Change: L586Q

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111559
AA Change: L556Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085
AA Change: L556Q

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Meta Mutation Damage Score 0.0376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Greb1l T C 18: 10,522,076 probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5893:Ablim1 UTSW 19 57215853 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGTACCTCTGGACAGGGCAATC -3'
(R):5'- TGAAGCCTAGCACTGGAAAGCTAAC -3'

Sequencing Primer
(F):5'- CTGGACAGGGCAATCTATTTTAAGC -3'
(R):5'- CTGGAAAGCTAACAGGGCTTC -3'
Posted On2013-05-09