Incidental Mutation 'R4553:Pld1'
ID341769
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
MMRRC Submission 041595-MU
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4553 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28124702 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 915 (R915L)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
Predicted Effect probably benign
Transcript: ENSMUST00000067757
AA Change: R915L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: R915L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120834
AA Change: R915L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: R915L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123539
AA Change: R953L
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: R953L

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126594
AA Change: R135L
SMART Domains Protein: ENSMUSP00000121569
Gene: ENSMUSG00000027695
AA Change: R135L

DomainStartEndE-ValueType
PLDc 74 101 1.34e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148827
AA Change: R749L
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: R749L

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,813,193 Y49C probably damaging Het
Adat1 T C 8: 111,990,280 T32A probably damaging Het
Adra2a T C 19: 54,046,735 V174A possibly damaging Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
Cand2 C A 6: 115,792,211 R661S probably damaging Het
Cd274 T C 19: 29,380,448 V180A probably benign Het
Crat T C 2: 30,408,217 T157A probably benign Het
Cts6 G A 13: 61,197,593 P230L probably damaging Het
Dppa2 A G 16: 48,310,514 Y3C possibly damaging Het
Epgn A T 5: 91,027,562 K14* probably null Het
Fam71f2 A G 6: 29,287,706 I210M probably benign Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Hgfac T A 5: 35,042,856 C130S probably damaging Het
Ifi35 T C 11: 101,457,891 V188A probably damaging Het
Iqsec2 A G X: 152,211,281 H585R probably benign Het
Itih4 T C 14: 30,900,953 L842P probably damaging Het
Kif3a C A 11: 53,578,918 L119I possibly damaging Het
Lrp2 T C 2: 69,513,285 D910G probably benign Het
Lyve1 T C 7: 110,852,360 probably null Het
Mtss1l A G 8: 110,738,505 T464A probably damaging Het
Mx2 A G 16: 97,552,005 T398A possibly damaging Het
Nlrp4e T C 7: 23,320,979 M297T probably benign Het
Nog A G 11: 89,301,422 L200P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Phf11b G A 14: 59,341,285 P11S probably benign Het
Plcb1 T C 2: 135,335,493 S582P probably benign Het
Sell C T 1: 164,072,116 T34I probably benign Het
Slc34a1 G A 13: 55,412,061 probably null Het
Slc8b1 T C 5: 120,529,598 V432A probably damaging Het
Tipin T A 9: 64,288,103 probably null Het
Vmn1r117 A T 7: 20,883,592 F177Y probably damaging Het
Xab2 T C 8: 3,611,015 T700A probably benign Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7440:Pld1 UTSW 3 28041270 missense probably benign 0.01
R7524:Pld1 UTSW 3 28024321 missense not run
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGAGAAGAAGCTTGAGTGTGTC -3'
(R):5'- ATCCTACCTATATAGTTTGACCTGGTC -3'

Sequencing Primer
(F):5'- AGAAGAAGCTTGAGTGTGTCTGTGG -3'
(R):5'- AAAAGGGGAATTCATGGTATTGTAC -3'
Posted On2015-09-24