Incidental Mutation 'R4553:Cd274'
ID 341795
Institutional Source Beutler Lab
Gene Symbol Cd274
Ensembl Gene ENSMUSG00000016496
Gene Name CD274 antigen
Synonyms Pdcd1lg1, PD-L1, B7-H1
MMRRC Submission 041595-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4553 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 29344855-29365495 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29357848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 180 (V180A)
Ref Sequence ENSEMBL: ENSMUSP00000016640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016640]
AlphaFold Q9EP73
Predicted Effect probably benign
Transcript: ENSMUST00000016640
AA Change: V180A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016640
Gene: ENSMUSG00000016496
AA Change: V180A

DomainStartEndE-ValueType
IG 24 131 1.5e-7 SMART
IG_like 138 226 4.78e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Mice deficient for this gene display a variety of phenotypes including decreased allogeneic fetal survival rates and severe experimental autoimmune encephalomyelitis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered susceptibility to experimental autoimmune encephalomyelitis, induced arthritis, nerve injury, autoimmune diabetes, bacterial infection, viral infection, and parasitic infection due to abnormal T cellmorphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik T C 5: 114,951,254 (GRCm39) Y49C probably damaging Het
Adat1 T C 8: 112,716,912 (GRCm39) T32A probably damaging Het
Adra2a T C 19: 54,035,166 (GRCm39) V174A possibly damaging Het
Armcx5 T A X: 134,647,256 (GRCm39) V444D probably damaging Het
Cand2 C A 6: 115,769,172 (GRCm39) R661S probably damaging Het
Crat T C 2: 30,298,229 (GRCm39) T157A probably benign Het
Cts6 G A 13: 61,345,407 (GRCm39) P230L probably damaging Het
Dppa2 A G 16: 48,130,877 (GRCm39) Y3C possibly damaging Het
Epgn A T 5: 91,175,421 (GRCm39) K14* probably null Het
Garin1a A G 6: 29,287,705 (GRCm39) I210M probably benign Het
Gsap A T 5: 21,495,569 (GRCm39) D79V probably damaging Het
Hgfac T A 5: 35,200,200 (GRCm39) C130S probably damaging Het
Ifi35 T C 11: 101,348,717 (GRCm39) V188A probably damaging Het
Iqsec2 A G X: 150,994,277 (GRCm39) H585R probably benign Het
Itih4 T C 14: 30,622,910 (GRCm39) L842P probably damaging Het
Kif3a C A 11: 53,469,745 (GRCm39) L119I possibly damaging Het
Lrp2 T C 2: 69,343,629 (GRCm39) D910G probably benign Het
Lyve1 T C 7: 110,451,567 (GRCm39) probably null Het
Mtss2 A G 8: 111,465,137 (GRCm39) T464A probably damaging Het
Mx2 A G 16: 97,353,205 (GRCm39) T398A possibly damaging Het
Nlrp4e T C 7: 23,020,404 (GRCm39) M297T probably benign Het
Nog A G 11: 89,192,248 (GRCm39) L200P probably damaging Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Papolb T C 5: 142,514,933 (GRCm39) I237V probably benign Het
Phf11b G A 14: 59,578,734 (GRCm39) P11S probably benign Het
Plcb1 T C 2: 135,177,413 (GRCm39) S582P probably benign Het
Pld1 G T 3: 28,178,851 (GRCm39) R915L probably benign Het
Sell C T 1: 163,899,685 (GRCm39) T34I probably benign Het
Slc34a1 G A 13: 55,559,874 (GRCm39) probably null Het
Slc8b1 T C 5: 120,667,663 (GRCm39) V432A probably damaging Het
Tipin T A 9: 64,195,385 (GRCm39) probably null Het
Vmn1r117 A T 7: 20,617,517 (GRCm39) F177Y probably damaging Het
Xab2 T C 8: 3,661,015 (GRCm39) T700A probably benign Het
Other mutations in Cd274
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Cd274 APN 19 29,362,810 (GRCm39) makesense probably null
IGL02232:Cd274 APN 19 29,359,938 (GRCm39) missense probably damaging 0.99
IGL03304:Cd274 APN 19 29,361,502 (GRCm39) missense probably damaging 0.99
R1233:Cd274 UTSW 19 29,351,301 (GRCm39) critical splice donor site probably null
R1356:Cd274 UTSW 19 29,350,970 (GRCm39) missense possibly damaging 0.92
R1464:Cd274 UTSW 19 29,359,992 (GRCm39) splice site probably benign
R1853:Cd274 UTSW 19 29,357,882 (GRCm39) missense probably damaging 1.00
R4280:Cd274 UTSW 19 29,357,871 (GRCm39) missense probably benign
R4283:Cd274 UTSW 19 29,357,871 (GRCm39) missense probably benign
R5063:Cd274 UTSW 19 29,361,543 (GRCm39) missense probably damaging 0.99
R5122:Cd274 UTSW 19 29,357,965 (GRCm39) missense possibly damaging 0.57
R5187:Cd274 UTSW 19 29,359,936 (GRCm39) missense probably benign 0.01
R5736:Cd274 UTSW 19 29,359,940 (GRCm39) missense probably benign 0.02
R6400:Cd274 UTSW 19 29,362,808 (GRCm39) missense probably damaging 1.00
R8114:Cd274 UTSW 19 29,361,528 (GRCm39) missense probably damaging 1.00
R8247:Cd274 UTSW 19 29,362,795 (GRCm39) nonsense probably null
R9099:Cd274 UTSW 19 29,357,771 (GRCm39) nonsense probably null
R9525:Cd274 UTSW 19 29,359,879 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACACGGCTAGCCCTAAGATG -3'
(R):5'- TGCTAAATGACTATGGCGGATG -3'

Sequencing Primer
(F):5'- CCACTTCTGAGCATGAAC -3'
(R):5'- ATGGCCATCGTGCTAGGAATC -3'
Posted On 2015-09-24