Incidental Mutation 'R4554:Zswim9'
ID341805
Institutional Source Beutler Lab
Gene Symbol Zswim9
Ensembl Gene ENSMUSG00000070814
Gene Namezinc finger SWIM-type containing 9
Synonyms6330408A02Rik
MMRRC Submission 041596-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4554 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13258967-13278721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13277162 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 87 (N87D)
Ref Sequence ENSEMBL: ENSMUSP00000104172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558] [ENSMUST00000123025] [ENSMUST00000144470] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]
Predicted Effect probably benign
Transcript: ENSMUST00000098814
SMART Domains Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108532
AA Change: N87D

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: N87D

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119139
AA Change: N87D

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: N87D

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119558
AA Change: N87D

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000123025
SMART Domains Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 159 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123846
SMART Domains Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140530
Predicted Effect probably benign
Transcript: ENSMUST00000144470
Predicted Effect probably benign
Transcript: ENSMUST00000146998
SMART Domains Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
low complexity region 160 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147735
SMART Domains Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148471
SMART Domains Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156525
SMART Domains Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 4e-47 PFAM
Pfam:DNA_ligase_A_M 556 687 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165964
SMART Domains Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 302 478 1.7e-40 PFAM
Pfam:DNA_ligase_A_M 556 760 1.1e-69 PFAM
Pfam:DNA_ligase_A_C 785 896 1.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177588
SMART Domains Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
Pfam:DNA_ligase_A_N 301 479 8.6e-50 PFAM
Pfam:DNA_ligase_A_M 556 760 3.4e-67 PFAM
Pfam:DNA_ligase_A_C 785 896 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185145
SMART Domains Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
coiled coil region 149 173 N/A INTRINSIC
PDB:1X9N|A 247 313 3e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211707
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 122,156,343 A1772V possibly damaging Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Adgrb3 T C 1: 25,084,279 R1414G probably damaging Het
Ahnak G A 19: 9,014,930 G4526D probably damaging Het
Alms1 G A 6: 85,624,617 R2150H probably benign Het
Amh A T 10: 80,807,051 E356D probably benign Het
Cap2 T A 13: 46,635,774 F152I probably damaging Het
Chil3 T G 3: 106,160,370 K160Q probably benign Het
Ep300 T A 15: 81,601,430 M206K unknown Het
Gm960 T C 19: 4,649,819 Q452R possibly damaging Het
Lsamp G C 16: 42,144,075 D271H probably damaging Het
Marf1 T C 16: 14,153,977 probably benign Het
Mfsd11 T G 11: 116,861,580 V133G probably damaging Het
Ngrn C T 7: 80,264,701 T200I possibly damaging Het
Olfr1084 T A 2: 86,638,779 N310Y possibly damaging Het
Phf20l1 A G 15: 66,597,367 T117A probably damaging Het
Pitpnm1 A G 19: 4,103,085 Q135R probably benign Het
Poc5 A G 13: 96,403,021 K357E probably benign Het
Rfx8 C T 1: 39,680,940 R325H probably benign Het
Rhbdd3 C T 11: 5,105,946 P366L probably benign Het
Rtl1 T C 12: 109,594,328 N359S possibly damaging Het
Ryr1 T C 7: 29,105,008 T499A probably benign Het
Tex2 G T 11: 106,544,386 P738H unknown Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmc5 T C 7: 118,670,733 I902T probably benign Het
Other mutations in Zswim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Zswim9 APN 7 13260321 missense possibly damaging 0.53
IGL02063:Zswim9 APN 7 13260681 missense probably damaging 0.98
R0568:Zswim9 UTSW 7 13261026 missense probably damaging 0.99
R0680:Zswim9 UTSW 7 13260321 missense probably benign 0.10
R1438:Zswim9 UTSW 7 13277218 missense possibly damaging 0.86
R1600:Zswim9 UTSW 7 13269571 missense probably damaging 1.00
R1678:Zswim9 UTSW 7 13277411 missense probably benign 0.04
R1745:Zswim9 UTSW 7 13269556 missense probably damaging 1.00
R1938:Zswim9 UTSW 7 13260214 nonsense probably null
R2025:Zswim9 UTSW 7 13269366 missense probably damaging 0.98
R3149:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3150:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3176:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3177:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3276:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3277:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3950:Zswim9 UTSW 7 13261577 missense possibly damaging 0.95
R4866:Zswim9 UTSW 7 13261169 missense probably damaging 0.99
R4953:Zswim9 UTSW 7 13269558 missense probably damaging 1.00
R5330:Zswim9 UTSW 7 13259985 missense probably damaging 1.00
R5394:Zswim9 UTSW 7 13260983 missense probably damaging 1.00
R5408:Zswim9 UTSW 7 13260826 missense possibly damaging 0.66
R5654:Zswim9 UTSW 7 13261168 missense probably damaging 0.99
R5810:Zswim9 UTSW 7 13260735 missense probably damaging 0.98
R5859:Zswim9 UTSW 7 13261445 missense probably damaging 0.99
R6235:Zswim9 UTSW 7 13261603 missense probably damaging 1.00
R6239:Zswim9 UTSW 7 13261331 nonsense probably null
R6249:Zswim9 UTSW 7 13260977 missense probably damaging 0.98
R6394:Zswim9 UTSW 7 13260963 missense probably damaging 0.99
R7077:Zswim9 UTSW 7 13259752 missense probably damaging 1.00
R7133:Zswim9 UTSW 7 13259737 missense probably damaging 0.98
R7178:Zswim9 UTSW 7 13259997 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AACCCTGTATATCAAGTCTGGGTTG -3'
(R):5'- TTCAGCCGCTTCTTCGACAAG -3'

Sequencing Primer
(F):5'- TGGCTCAGACTCCATCTCAGTAAG -3'
(R):5'- CTTCTTCGACAAGTGGTGCCAG -3'
Posted On2015-09-24