Incidental Mutation 'R4554:Rtl1'
ID 341818
Institutional Source Beutler Lab
Gene Symbol Rtl1
Ensembl Gene ENSMUSG00000085925
Gene Name retrotransposon Gaglike 1
Synonyms Mart1, Mar, Mor1
MMRRC Submission 041596-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4554 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 109555627-109566764 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109560762 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 359 (N359S)
Ref Sequence ENSEMBL: ENSMUSP00000115957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000149046]
AlphaFold Q7M732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093625
Predicted Effect possibly damaging
Transcript: ENSMUST00000149046
AA Change: N359S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115957
Gene: ENSMUSG00000085925
AA Change: N359S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 41 80 N/A INTRINSIC
internal_repeat_1 88 163 8.8e-50 PROSPERO
internal_repeat_1 176 251 8.8e-50 PROSPERO
low complexity region 332 361 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 393 408 N/A INTRINSIC
Pfam:DUF4939 432 538 1.6e-14 PFAM
Pfam:Retrotrans_gag 493 586 9.2e-13 PFAM
low complexity region 611 632 N/A INTRINSIC
Pfam:gag-asp_proteas 663 731 2.3e-15 PFAM
low complexity region 833 849 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
PDB:4OL8|E 988 1192 6e-17 PDB
Blast:CYCc 989 1158 5e-9 BLAST
SCOP:d1sig__ 1291 1443 2e-4 SMART
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199494
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a retrotransposon-derived, paternally expressed imprinted gene that is highly expressed at the late fetal stage in both the fetus and placenta. It has an overlapping maternally expressed antisense transcript, which contains several microRNAs targeting the transcripts of this gene through an RNA interference (RNAi) mechanism. This gene is essential for maintenance of the fetal capillaries. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice heterozygous for a paternally inherited knock-out allele exhibit fetal/neonatal lethality associated with underdevelopment of the placenta. Mice heteroygous for a maternally inherited knock-out allele exhibit neonatal lethality and decreased survival associated with placental overdevelopment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C T 3: 121,949,992 (GRCm39) A1772V possibly damaging Het
Adamts17 A T 7: 66,677,641 (GRCm39) E518D probably damaging Het
Adgrb3 T C 1: 25,123,360 (GRCm39) R1414G probably damaging Het
Ahnak G A 19: 8,992,294 (GRCm39) G4526D probably damaging Het
Alms1 G A 6: 85,601,599 (GRCm39) R2150H probably benign Het
Amh A T 10: 80,642,885 (GRCm39) E356D probably benign Het
Cap2 T A 13: 46,789,250 (GRCm39) F152I probably damaging Het
Chil3 T G 3: 106,067,686 (GRCm39) K160Q probably benign Het
Ep300 T A 15: 81,485,631 (GRCm39) M206K unknown Het
Lsamp G C 16: 41,964,438 (GRCm39) D271H probably damaging Het
Marf1 T C 16: 13,971,841 (GRCm39) probably benign Het
Mfsd11 T G 11: 116,752,406 (GRCm39) V133G probably damaging Het
Ngrn C T 7: 79,914,449 (GRCm39) T200I possibly damaging Het
Or8k37 T A 2: 86,469,123 (GRCm39) N310Y possibly damaging Het
Phf20l1 A G 15: 66,469,216 (GRCm39) T117A probably damaging Het
Pitpnm1 A G 19: 4,153,085 (GRCm39) Q135R probably benign Het
Poc5 A G 13: 96,539,529 (GRCm39) K357E probably benign Het
Rfx8 C T 1: 39,720,100 (GRCm39) R325H probably benign Het
Rhbdd3 C T 11: 5,055,946 (GRCm39) P366L probably benign Het
Ryr1 T C 7: 28,804,433 (GRCm39) T499A probably benign Het
Tex2 G T 11: 106,435,212 (GRCm39) P738H unknown Het
Thap12 A G 7: 98,365,052 (GRCm39) N407D probably benign Het
Tmc5 T C 7: 118,269,956 (GRCm39) I902T probably benign Het
Top6bl T C 19: 4,699,847 (GRCm39) Q452R possibly damaging Het
Zswim9 T C 7: 13,011,088 (GRCm39) N87D probably benign Het
Other mutations in Rtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Rtl1 APN 12 109,559,434 (GRCm39) missense probably benign 0.00
IGL01981:Rtl1 APN 12 109,558,369 (GRCm39) missense possibly damaging 0.72
IGL02418:Rtl1 APN 12 109,556,883 (GRCm39) missense probably damaging 1.00
IGL03164:Rtl1 APN 12 109,559,367 (GRCm39) missense probably damaging 1.00
FR4304:Rtl1 UTSW 12 109,557,632 (GRCm39) small deletion probably benign
R0109:Rtl1 UTSW 12 109,561,841 (GRCm39) start gained probably benign
R0141:Rtl1 UTSW 12 109,559,382 (GRCm39) missense probably damaging 1.00
R0312:Rtl1 UTSW 12 109,556,661 (GRCm39) missense probably damaging 0.99
R0389:Rtl1 UTSW 12 109,556,797 (GRCm39) missense possibly damaging 0.77
R0390:Rtl1 UTSW 12 109,557,820 (GRCm39) missense unknown
R0548:Rtl1 UTSW 12 109,558,089 (GRCm39) missense probably damaging 0.98
R0561:Rtl1 UTSW 12 109,560,363 (GRCm39) missense probably damaging 0.99
R0624:Rtl1 UTSW 12 109,559,153 (GRCm39) missense probably damaging 0.97
R0746:Rtl1 UTSW 12 109,559,394 (GRCm39) missense probably damaging 1.00
R1353:Rtl1 UTSW 12 109,558,633 (GRCm39) missense probably benign 0.00
R1868:Rtl1 UTSW 12 109,556,970 (GRCm39) missense probably damaging 1.00
R1935:Rtl1 UTSW 12 109,558,354 (GRCm39) missense probably benign 0.42
R2000:Rtl1 UTSW 12 109,560,321 (GRCm39) missense probably damaging 1.00
R2094:Rtl1 UTSW 12 109,557,831 (GRCm39) missense unknown
R2125:Rtl1 UTSW 12 109,560,355 (GRCm39) missense possibly damaging 0.64
R2166:Rtl1 UTSW 12 109,556,988 (GRCm39) missense probably damaging 1.00
R2247:Rtl1 UTSW 12 109,561,413 (GRCm39) missense possibly damaging 0.77
R2274:Rtl1 UTSW 12 109,561,101 (GRCm39) missense unknown
R2919:Rtl1 UTSW 12 109,557,582 (GRCm39) missense unknown
R2998:Rtl1 UTSW 12 109,561,530 (GRCm39) missense probably damaging 0.99
R4566:Rtl1 UTSW 12 109,559,293 (GRCm39) missense probably damaging 1.00
R4887:Rtl1 UTSW 12 109,558,138 (GRCm39) missense probably damaging 0.96
R5399:Rtl1 UTSW 12 109,556,736 (GRCm39) missense probably damaging 1.00
R5512:Rtl1 UTSW 12 109,557,805 (GRCm39) missense unknown
R5616:Rtl1 UTSW 12 109,559,173 (GRCm39) missense unknown
R5644:Rtl1 UTSW 12 109,558,013 (GRCm39) missense probably benign 0.03
R5647:Rtl1 UTSW 12 109,561,113 (GRCm39) missense unknown
R5695:Rtl1 UTSW 12 109,560,531 (GRCm39) missense probably damaging 1.00
R5714:Rtl1 UTSW 12 109,560,114 (GRCm39) missense probably damaging 0.99
R5786:Rtl1 UTSW 12 109,559,053 (GRCm39) missense possibly damaging 0.89
R5917:Rtl1 UTSW 12 109,558,087 (GRCm39) missense possibly damaging 0.82
R5948:Rtl1 UTSW 12 109,557,033 (GRCm39) missense possibly damaging 0.86
R6051:Rtl1 UTSW 12 109,559,458 (GRCm39) missense probably damaging 1.00
R6251:Rtl1 UTSW 12 109,560,083 (GRCm39) missense probably benign 0.16
R6342:Rtl1 UTSW 12 109,558,735 (GRCm39) missense possibly damaging 0.50
R6433:Rtl1 UTSW 12 109,561,630 (GRCm39) missense unknown
R6815:Rtl1 UTSW 12 109,560,937 (GRCm39) missense probably damaging 0.98
R6968:Rtl1 UTSW 12 109,561,113 (GRCm39) missense unknown
R7002:Rtl1 UTSW 12 109,560,381 (GRCm39) missense probably damaging 0.97
R7020:Rtl1 UTSW 12 109,558,749 (GRCm39) missense possibly damaging 0.72
R7026:Rtl1 UTSW 12 109,559,595 (GRCm39) missense probably damaging 0.99
R7027:Rtl1 UTSW 12 109,557,848 (GRCm39) small deletion probably benign
R7196:Rtl1 UTSW 12 109,559,221 (GRCm39) missense possibly damaging 0.83
R7239:Rtl1 UTSW 12 109,558,909 (GRCm39) missense probably benign 0.05
R7312:Rtl1 UTSW 12 109,561,672 (GRCm39) missense unknown
R7476:Rtl1 UTSW 12 109,557,539 (GRCm39) missense unknown
R7589:Rtl1 UTSW 12 109,560,279 (GRCm39) missense possibly damaging 0.91
R7655:Rtl1 UTSW 12 109,557,442 (GRCm39) missense unknown
R7656:Rtl1 UTSW 12 109,557,442 (GRCm39) missense unknown
R7657:Rtl1 UTSW 12 109,561,818 (GRCm39) missense possibly damaging 0.94
R7720:Rtl1 UTSW 12 109,560,864 (GRCm39) missense possibly damaging 0.96
R7772:Rtl1 UTSW 12 109,559,619 (GRCm39) missense probably damaging 1.00
R7840:Rtl1 UTSW 12 109,560,589 (GRCm39) missense probably benign 0.08
R7890:Rtl1 UTSW 12 109,559,251 (GRCm39) missense possibly damaging 0.57
R7893:Rtl1 UTSW 12 109,560,355 (GRCm39) missense possibly damaging 0.64
R7894:Rtl1 UTSW 12 109,561,031 (GRCm39) missense possibly damaging 0.70
R7909:Rtl1 UTSW 12 109,558,914 (GRCm39) missense possibly damaging 0.95
R7909:Rtl1 UTSW 12 109,556,611 (GRCm39) missense unknown
R7986:Rtl1 UTSW 12 109,558,492 (GRCm39) missense possibly damaging 0.95
R8007:Rtl1 UTSW 12 109,558,060 (GRCm39) missense possibly damaging 0.86
R8146:Rtl1 UTSW 12 109,557,145 (GRCm39) missense probably benign 0.01
R8193:Rtl1 UTSW 12 109,558,650 (GRCm39) missense probably benign 0.03
R8263:Rtl1 UTSW 12 109,560,180 (GRCm39) missense probably damaging 0.99
R8273:Rtl1 UTSW 12 109,559,149 (GRCm39) missense possibly damaging 0.92
R8512:Rtl1 UTSW 12 109,561,051 (GRCm39) missense unknown
R8514:Rtl1 UTSW 12 109,560,307 (GRCm39) missense possibly damaging 0.52
R8748:Rtl1 UTSW 12 109,561,492 (GRCm39) missense probably benign 0.39
R9036:Rtl1 UTSW 12 109,559,691 (GRCm39) missense probably benign 0.03
R9104:Rtl1 UTSW 12 109,560,718 (GRCm39) missense probably benign 0.21
R9151:Rtl1 UTSW 12 109,560,007 (GRCm39) missense
R9238:Rtl1 UTSW 12 109,561,017 (GRCm39) missense possibly damaging 0.72
R9292:Rtl1 UTSW 12 109,556,673 (GRCm39) missense possibly damaging 0.91
R9329:Rtl1 UTSW 12 109,556,673 (GRCm39) missense possibly damaging 0.91
R9332:Rtl1 UTSW 12 109,557,291 (GRCm39) missense probably benign 0.01
R9342:Rtl1 UTSW 12 109,558,884 (GRCm39) missense probably damaging 1.00
R9350:Rtl1 UTSW 12 109,557,226 (GRCm39) nonsense probably null
R9446:Rtl1 UTSW 12 109,556,604 (GRCm39) makesense probably null
R9523:Rtl1 UTSW 12 109,561,113 (GRCm39) missense unknown
R9524:Rtl1 UTSW 12 109,556,973 (GRCm39) missense probably damaging 1.00
R9535:Rtl1 UTSW 12 109,561,698 (GRCm39) missense unknown
R9535:Rtl1 UTSW 12 109,557,171 (GRCm39) missense probably damaging 1.00
R9564:Rtl1 UTSW 12 109,556,713 (GRCm39) missense probably benign 0.19
R9615:Rtl1 UTSW 12 109,556,835 (GRCm39) missense possibly damaging 0.65
R9661:Rtl1 UTSW 12 109,557,346 (GRCm39) missense possibly damaging 0.79
R9674:Rtl1 UTSW 12 109,559,024 (GRCm39) missense possibly damaging 0.50
R9720:Rtl1 UTSW 12 109,559,882 (GRCm39) missense possibly damaging 0.50
Z1088:Rtl1 UTSW 12 109,558,753 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAACAGCGAGATGACGTTC -3'
(R):5'- AAACCCAGAGTCGAGCGATG -3'

Sequencing Primer
(F):5'- AGATGACGTTCCCCATGGTG -3'
(R):5'- AGTCGAGCGATGTTTCCAAC -3'
Posted On 2015-09-24