Mutagenetix > Incidental Mutation

Incidental Mutation 'R4555:Adamts17'

341834

Institutional Source

Beutler Lab

Gene Symbol

Adamts17

Ensembl Gene

ENSMUSG00000058145

Gene Name

ADAM metallopeptidase with thrombospondin type 1 motif 17

Synonyms

AU023434

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R4555 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66489483-66802919 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66677641 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 518 (E518D)

Ref Sequence

ENSEMBL: ENSMUSP00000095984 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]

AlphaFold

E9Q4D1

Predicted Effect

probably damaging
Transcript: ENSMUST00000098382
AA Change: E518D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: E518D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	35	179	2.9e-25	PFAM
Pfam:Reprolysin_5	228	422	3.1e-15	PFAM
Pfam:Reprolysin_2	248	440	6.1e-13	PFAM
Pfam:Reprolysin_3	252	398	2.2e-12	PFAM
Pfam:Reprolysin_4	328	446	7.1e-10	PFAM
Pfam:Reprolysin	334	450	2e-18	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	698	808	6.4e-30	PFAM
TSP1	829	887	1.81e-1	SMART
TSP1	889	942	1.15e-4	SMART
TSP1	949	993	4.05e-5	SMART
TSP1	1000	1054	2.91e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107478
AA Change: E518D

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: E518D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	180	3.1e-23	PFAM
Pfam:Reprolysin_5	228	424	3.2e-15	PFAM
Pfam:Reprolysin_2	248	440	5.9e-11	PFAM
Pfam:Reprolysin_3	252	398	6e-12	PFAM
Pfam:Reprolysin_4	328	446	6.8e-10	PFAM
Pfam:Reprolysin	334	450	4.3e-21	PFAM
Blast:ACR	454	533	3e-12	BLAST
TSP1	544	596	2.2e-15	SMART
Pfam:ADAM_spacer1	700	781	2.2e-16	PFAM
TSP1	802	860	1.81e-1	SMART
TSP1	862	915	1.15e-4	SMART
TSP1	922	966	4.05e-5	SMART
TSP1	973	1027	2.91e-6	SMART
Pfam:PLAC	1046	1080	1.1e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147880

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148538

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830005F24Rik	T	C	13: 48,667,937 (GRCm39)		probably benign	Het
Adamts16	G	A	13: 70,927,637 (GRCm39)		probably benign	Het
Afp	T	G	5: 90,654,546 (GRCm39)	I528S	possibly damaging	Het
Cul9	T	C	17: 46,812,755 (GRCm39)	D2407G	possibly damaging	Het
Cyp19a1	T	C	9: 54,074,105 (GRCm39)	E483G	probably damaging	Het
Dennd2c	G	A	3: 103,039,202 (GRCm39)	V117I	probably benign	Het
Inha	C	T	1: 75,486,227 (GRCm39)	P174L	possibly damaging	Het
Myo15a	A	G	11: 60,387,763 (GRCm39)	R746G	probably damaging	Het
Ndufaf7	T	C	17: 79,249,516 (GRCm39)	S138P	probably benign	Het
Osmr	T	C	15: 6,845,201 (GRCm39)	Q855R	possibly damaging	Het
Pip4k2a	C	T	2: 18,877,103 (GRCm39)	D211N	probably damaging	Het
Pitpnm1	A	G	19: 4,153,085 (GRCm39)	Q135R	probably benign	Het
Plxna1	G	T	6: 89,300,310 (GRCm39)	T1591K	probably damaging	Het
Rdh19	T	A	10: 127,686,020 (GRCm39)	L44Q	probably benign	Het
Rom1	T	C	19: 8,905,380 (GRCm39)	T267A	possibly damaging	Het
Smad3	C	T	9: 63,562,070 (GRCm39)	V108I	possibly damaging	Het
Sptb	A	C	12: 76,659,625 (GRCm39)	S1092A	probably benign	Het
Thap12	A	G	7: 98,365,052 (GRCm39)	N407D	probably benign	Het
Tmc5	T	C	7: 118,269,956 (GRCm39)	I902T	probably benign	Het
Ugt1a6a	C	T	1: 88,066,349 (GRCm39)	R52*	probably null	Het
Usp54	C	T	14: 20,611,090 (GRCm39)	R1242H	probably benign	Het
Vps16	T	C	2: 130,285,496 (GRCm39)	V813A	probably damaging	Het

Other mutations in Adamts17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Adamts17	APN	7	66,618,650 (GRCm39)	missense	probably damaging	1.00
IGL00950:Adamts17	APN	7	66,770,660 (GRCm39)	missense	possibly damaging	0.69
IGL01532:Adamts17	APN	7	66,558,349 (GRCm39)	missense	probably damaging	1.00
IGL01591:Adamts17	APN	7	66,654,144 (GRCm39)	missense	probably damaging	1.00
IGL01602:Adamts17	APN	7	66,538,159 (GRCm39)	missense	probably benign	0.29
IGL01640:Adamts17	APN	7	66,679,428 (GRCm39)	missense	probably damaging	0.98
IGL01686:Adamts17	APN	7	66,490,037 (GRCm39)	missense	probably benign	0.06
IGL01747:Adamts17	APN	7	66,701,759 (GRCm39)	missense	probably damaging	1.00
IGL02081:Adamts17	APN	7	66,711,858 (GRCm39)	missense	probably damaging	1.00
IGL02152:Adamts17	APN	7	66,774,748 (GRCm39)	missense	probably benign	0.01
IGL02264:Adamts17	APN	7	66,697,207 (GRCm39)	splice site	probably null
IGL02457:Adamts17	APN	7	66,677,562 (GRCm39)	missense	probably damaging	0.99
IGL02519:Adamts17	APN	7	66,774,721 (GRCm39)	missense	possibly damaging	0.82
IGL02530:Adamts17	APN	7	66,559,124 (GRCm39)	missense	probably damaging	1.00
IGL02649:Adamts17	APN	7	66,499,626 (GRCm39)	splice site	probably benign
IGL02711:Adamts17	APN	7	66,701,788 (GRCm39)	splice site	probably benign
IGL03006:Adamts17	APN	7	66,728,095 (GRCm39)	missense	possibly damaging	0.53
IGL03203:Adamts17	APN	7	66,711,856 (GRCm39)	missense	probably damaging	1.00
IGL03343:Adamts17	APN	7	66,725,064 (GRCm39)	missense	probably damaging	1.00
BB007:Adamts17	UTSW	7	66,499,547 (GRCm39)	missense	probably damaging	0.96
BB017:Adamts17	UTSW	7	66,499,547 (GRCm39)	missense	probably damaging	0.96
E2594:Adamts17	UTSW	7	66,654,098 (GRCm39)	missense	probably damaging	1.00
R0380:Adamts17	UTSW	7	66,799,792 (GRCm39)	missense	probably benign	0.00
R0416:Adamts17	UTSW	7	66,565,646 (GRCm39)	splice site	probably null
R0635:Adamts17	UTSW	7	66,558,353 (GRCm39)	missense	probably damaging	1.00
R1083:Adamts17	UTSW	7	66,797,322 (GRCm39)	missense	probably damaging	1.00
R1476:Adamts17	UTSW	7	66,725,091 (GRCm39)	missense	probably damaging	1.00
R1728:Adamts17	UTSW	7	66,799,704 (GRCm39)	nonsense	probably null
R1729:Adamts17	UTSW	7	66,799,704 (GRCm39)	nonsense	probably null
R1763:Adamts17	UTSW	7	66,797,463 (GRCm39)	missense	probably damaging	1.00
R1784:Adamts17	UTSW	7	66,799,704 (GRCm39)	nonsense	probably null
R1905:Adamts17	UTSW	7	66,697,220 (GRCm39)	nonsense	probably null
R1938:Adamts17	UTSW	7	66,774,820 (GRCm39)	missense	probably damaging	1.00
R3106:Adamts17	UTSW	7	66,774,820 (GRCm39)	missense	probably damaging	1.00
R3796:Adamts17	UTSW	7	66,489,662 (GRCm39)	splice site	probably null
R3849:Adamts17	UTSW	7	66,490,215 (GRCm39)	missense	possibly damaging	0.92
R3850:Adamts17	UTSW	7	66,490,215 (GRCm39)	missense	possibly damaging	0.92
R3945:Adamts17	UTSW	7	66,770,687 (GRCm39)	missense	probably benign
R4519:Adamts17	UTSW	7	66,490,314 (GRCm39)	missense	probably damaging	0.99
R4554:Adamts17	UTSW	7	66,677,641 (GRCm39)	missense	probably damaging	1.00
R4556:Adamts17	UTSW	7	66,677,641 (GRCm39)	missense	probably damaging	1.00
R4557:Adamts17	UTSW	7	66,677,641 (GRCm39)	missense	probably damaging	1.00
R4700:Adamts17	UTSW	7	66,691,636 (GRCm39)	missense	probably damaging	1.00
R4752:Adamts17	UTSW	7	66,654,218 (GRCm39)	missense	probably damaging	0.96
R5019:Adamts17	UTSW	7	66,711,818 (GRCm39)	nonsense	probably null
R5438:Adamts17	UTSW	7	66,538,165 (GRCm39)	missense	probably benign	0.30
R5444:Adamts17	UTSW	7	66,691,647 (GRCm39)	missense	probably benign	0.02
R5673:Adamts17	UTSW	7	66,691,555 (GRCm39)	missense	probably damaging	1.00
R6326:Adamts17	UTSW	7	66,770,636 (GRCm39)	missense	probably benign	0.05
R6964:Adamts17	UTSW	7	66,654,101 (GRCm39)	missense	probably benign	0.00
R6964:Adamts17	UTSW	7	66,559,148 (GRCm39)	missense	possibly damaging	0.93
R7129:Adamts17	UTSW	7	66,770,758 (GRCm39)	missense	probably damaging	1.00
R7317:Adamts17	UTSW	7	66,490,304 (GRCm39)	nonsense	probably null
R7355:Adamts17	UTSW	7	66,725,052 (GRCm39)	missense
R7386:Adamts17	UTSW	7	66,618,597 (GRCm39)	missense	probably benign	0.25
R7407:Adamts17	UTSW	7	66,697,304 (GRCm39)	nonsense	probably null
R7432:Adamts17	UTSW	7	66,701,665 (GRCm39)	missense
R7782:Adamts17	UTSW	7	66,774,802 (GRCm39)	missense	probably damaging	1.00
R7817:Adamts17	UTSW	7	66,559,224 (GRCm39)	missense	probably damaging	0.99
R7930:Adamts17	UTSW	7	66,499,547 (GRCm39)	missense	probably damaging	0.96
R7993:Adamts17	UTSW	7	66,499,612 (GRCm39)	missense	possibly damaging	0.90
R8178:Adamts17	UTSW	7	66,499,464 (GRCm39)	missense	possibly damaging	0.46
R8962:Adamts17	UTSW	7	66,725,057 (GRCm39)	missense	probably damaging	1.00
R9095:Adamts17	UTSW	7	66,654,117 (GRCm39)	missense	probably damaging	1.00
R9111:Adamts17	UTSW	7	66,489,648 (GRCm39)	missense	probably damaging	0.96
R9303:Adamts17	UTSW	7	66,489,645 (GRCm39)	missense	probably damaging	0.99
R9305:Adamts17	UTSW	7	66,489,645 (GRCm39)	missense	probably damaging	0.99
R9505:Adamts17	UTSW	7	66,774,683 (GRCm39)	missense	probably benign	0.00
R9668:Adamts17	UTSW	7	66,797,438 (GRCm39)	missense	possibly damaging	0.61
X0022:Adamts17	UTSW	7	66,691,649 (GRCm39)	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CAAGTCCCAGATCTGAGCAG -3'
(R):5'- GGAAATGACTGATTCTTGTGGCTTC -3'

Sequencing Primer
(F):5'- GATCTGAGCAGTAATCTCTCCATGG -3'
(R):5'- GCTTCACAAGAAACAAGGAGTGACTC -3'

Posted On

2015-09-24