Incidental Mutation 'R4556:Ccdc109b'
ID341861
Institutional Source Beutler Lab
Gene Symbol Ccdc109b
Ensembl Gene ENSMUSG00000027994
Gene Namecoiled-coil domain containing 109B
Synonyms
MMRRC Submission 041597-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4556 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129914960-129970206 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 129915735 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 310 (Q310*)
Ref Sequence ENSEMBL: ENSMUSP00000029624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029624] [ENSMUST00000029626] [ENSMUST00000153506]
Predicted Effect probably null
Transcript: ENSMUST00000029624
AA Change: Q310*
SMART Domains Protein: ENSMUSP00000029624
Gene: ENSMUSG00000027994
AA Change: Q310*

DomainStartEndE-ValueType
Pfam:MCU 109 314 4.4e-68 PFAM
low complexity region 323 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000029626
SMART Domains Protein: ENSMUSP00000029626
Gene: ENSMUSG00000027997

DomainStartEndE-ValueType
CASc 19 272 6.84e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146340
SMART Domains Protein: ENSMUSP00000115224
Gene: ENSMUSG00000027994

DomainStartEndE-ValueType
Pfam:MCU 34 149 2.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152622
Predicted Effect probably benign
Transcript: ENSMUST00000153506
SMART Domains Protein: ENSMUSP00000118170
Gene: ENSMUSG00000027994

DomainStartEndE-ValueType
low complexity region 178 202 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Cdk5rap2 A G 4: 70,239,312 S1601P probably damaging Het
Erc2 A C 14: 28,302,904 D580A probably damaging Het
Fbxo4 A G 15: 3,965,705 *386R probably null Het
Fbxo42 T A 4: 141,199,010 H334Q probably damaging Het
Gdf5 A G 2: 155,941,862 R24G probably benign Het
Lama3 G T 18: 12,479,759 R1200L possibly damaging Het
Lxn T A 3: 67,458,620 I182F possibly damaging Het
Mbd5 G A 2: 49,279,394 G1526R probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Nktr A G 9: 121,741,123 T90A probably damaging Het
Nr1h5 G A 3: 102,946,141 A350V probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr868 T C 9: 20,101,323 L188P possibly damaging Het
Pros1 A G 16: 62,900,673 K197R possibly damaging Het
Rmnd5b G T 11: 51,626,905 probably null Het
Rnf25 A T 1: 74,599,105 I26N probably damaging Het
Scn4a T C 11: 106,320,446 I1582V probably benign Het
Sh2d3c A G 2: 32,753,009 T583A possibly damaging Het
Sh3tc1 T C 5: 35,707,082 Y587C probably damaging Het
Slc6a11 A G 6: 114,244,812 S488G probably benign Het
Smim22 T A 16: 5,007,866 F38L possibly damaging Het
Stab2 T G 10: 86,967,679 E335D possibly damaging Het
Tas2r102 T C 6: 132,762,915 F262S probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmem225 T C 9: 40,149,466 F107S probably damaging Het
Vmn1r229 T A 17: 20,814,691 V66E possibly damaging Het
Vmn1r27 A G 6: 58,215,819 S67P possibly damaging Het
Xrcc4 A T 13: 89,992,504 H195Q probably benign Het
Other mutations in Ccdc109b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Ccdc109b UTSW 3 129933765 splice site probably benign
R0632:Ccdc109b UTSW 3 129918726 missense probably benign 0.00
R1471:Ccdc109b UTSW 3 129915815 missense probably damaging 1.00
R1740:Ccdc109b UTSW 3 129918727 missense probably benign 0.12
R1894:Ccdc109b UTSW 3 129934663 missense probably benign 0.41
R2104:Ccdc109b UTSW 3 129918688 missense probably benign 0.12
R4777:Ccdc109b UTSW 3 129969951 missense probably damaging 0.97
R4871:Ccdc109b UTSW 3 129917036 nonsense probably null
R5213:Ccdc109b UTSW 3 129916997 missense probably benign 0.01
R5587:Ccdc109b UTSW 3 129916970 missense probably benign 0.01
R5605:Ccdc109b UTSW 3 129917009 missense probably damaging 1.00
R5740:Ccdc109b UTSW 3 129918725 missense probably benign 0.01
R6031:Ccdc109b UTSW 3 129926389 missense probably damaging 1.00
R6031:Ccdc109b UTSW 3 129926389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTCATAAAGTACCAGGG -3'
(R):5'- GCCACTGTAGATACCTATGGCC -3'

Sequencing Primer
(F):5'- GAATTAATTCCCTTTCGCCATTTTTC -3'
(R):5'- ACTGTAGATACCTATGGCCCTTCC -3'
Posted On2015-09-24