Incidental Mutation 'R4556:Fbxo4'
ID341882
Institutional Source Beutler Lab
Gene Symbol Fbxo4
Ensembl Gene ENSMUSG00000022184
Gene NameF-box protein 4
Synonyms
MMRRC Submission 041597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4556 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location3965445-3979573 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 3965705 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 386 (*386R)
Ref Sequence ENSEMBL: ENSMUSP00000022791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022791]
Predicted Effect probably null
Transcript: ENSMUST00000022791
AA Change: *386R
SMART Domains Protein: ENSMUSP00000022791
Gene: ENSMUSG00000022184
AA Change: *386R

DomainStartEndE-ValueType
FBOX 60 100 5.57e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148817
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele exhibit increased tumor incidence of lymphoblastic lineage and premature death. Mice homozygous for a different knock-out allele are indistinguishable from wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830005F24Rik T C 13: 48,514,461 probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adamts17 A T 7: 67,027,893 E518D probably damaging Het
Ccdc109b G A 3: 129,915,735 Q310* probably null Het
Cdk5rap2 A G 4: 70,239,312 S1601P probably damaging Het
Erc2 A C 14: 28,302,904 D580A probably damaging Het
Fbxo42 T A 4: 141,199,010 H334Q probably damaging Het
Gdf5 A G 2: 155,941,862 R24G probably benign Het
Lama3 G T 18: 12,479,759 R1200L possibly damaging Het
Lxn T A 3: 67,458,620 I182F possibly damaging Het
Mbd5 G A 2: 49,279,394 G1526R probably damaging Het
Ndufaf7 T C 17: 78,942,087 S138P probably benign Het
Nktr A G 9: 121,741,123 T90A probably damaging Het
Nr1h5 G A 3: 102,946,141 A350V probably benign Het
Olfr389 G A 11: 73,776,481 T282I possibly damaging Het
Olfr868 T C 9: 20,101,323 L188P possibly damaging Het
Pros1 A G 16: 62,900,673 K197R possibly damaging Het
Rmnd5b G T 11: 51,626,905 probably null Het
Rnf25 A T 1: 74,599,105 I26N probably damaging Het
Scn4a T C 11: 106,320,446 I1582V probably benign Het
Sh2d3c A G 2: 32,753,009 T583A possibly damaging Het
Sh3tc1 T C 5: 35,707,082 Y587C probably damaging Het
Slc6a11 A G 6: 114,244,812 S488G probably benign Het
Smim22 T A 16: 5,007,866 F38L possibly damaging Het
Stab2 T G 10: 86,967,679 E335D possibly damaging Het
Tas2r102 T C 6: 132,762,915 F262S probably damaging Het
Thap12 A G 7: 98,715,845 N407D probably benign Het
Tmem225 T C 9: 40,149,466 F107S probably damaging Het
Vmn1r229 T A 17: 20,814,691 V66E possibly damaging Het
Vmn1r27 A G 6: 58,215,819 S67P possibly damaging Het
Xrcc4 A T 13: 89,992,504 H195Q probably benign Het
Other mutations in Fbxo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Fbxo4 APN 15 3965755 nonsense probably null
IGL01879:Fbxo4 APN 15 3975954 missense probably damaging 0.99
IGL03070:Fbxo4 APN 15 3977862 missense possibly damaging 0.63
PIT1430001:Fbxo4 UTSW 15 3979300 missense probably benign 0.07
R1601:Fbxo4 UTSW 15 3968965 missense possibly damaging 0.77
R4557:Fbxo4 UTSW 15 3965705 makesense probably null
R4783:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4784:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4785:Fbxo4 UTSW 15 3969041 missense probably benign 0.11
R4871:Fbxo4 UTSW 15 3975912 missense probably damaging 1.00
R5023:Fbxo4 UTSW 15 3977756 splice site probably null
R5435:Fbxo4 UTSW 15 3965792 missense possibly damaging 0.73
R5876:Fbxo4 UTSW 15 3977819 missense probably damaging 1.00
R6423:Fbxo4 UTSW 15 3965792 missense possibly damaging 0.73
R6481:Fbxo4 UTSW 15 3965734 missense probably damaging 1.00
R6656:Fbxo4 UTSW 15 3975823 missense probably damaging 0.99
R6999:Fbxo4 UTSW 15 3977955 missense probably damaging 1.00
X0028:Fbxo4 UTSW 15 3971451 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTACTATTCCTATCGGGCAAC -3'
(R):5'- AACTTTATATGCCCCAGTACAAGG -3'

Sequencing Primer
(F):5'- ATGTGAGAGTTCATTTTGTGGAAAAG -3'
(R):5'- GACTTTTGGTATAGCATTGGAAATG -3'
Posted On2015-09-24