Incidental Mutation 'R4569:Mgst1'
ID341997
Institutional Source Beutler Lab
Gene Symbol Mgst1
Ensembl Gene ENSMUSG00000008540
Gene Namemicrosomal glutathione S-transferase 1
Synonyms
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location138140316-138156755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 138156215 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 176 (T176K)
Ref Sequence ENSEMBL: ENSMUSP00000112923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008684] [ENSMUST00000118091] [ENSMUST00000120230] [ENSMUST00000120302] [ENSMUST00000120939] [ENSMUST00000140932] [ENSMUST00000204628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008684
AA Change: T102K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000008684
Gene: ENSMUSG00000008540
AA Change: T102K

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118091
AA Change: T176K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112923
Gene: ENSMUSG00000008540
AA Change: T176K

DomainStartEndE-ValueType
Pfam:MAPEG 90 224 1.9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120230
AA Change: T102K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113859
Gene: ENSMUSG00000008540
AA Change: T102K

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120302
AA Change: T102K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113257
Gene: ENSMUSG00000008540
AA Change: T102K

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120939
SMART Domains Protein: ENSMUSP00000112646
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
PDB:2H8A|A 2 74 1e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140932
SMART Domains Protein: ENSMUSP00000145306
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
Pfam:MAPEG 1 46 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204628
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Mgst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Mgst1 APN 6 138147768 missense probably damaging 0.99
R0319:Mgst1 UTSW 6 138156157 missense possibly damaging 0.81
R0613:Mgst1 UTSW 6 138156245 missense probably damaging 1.00
R0634:Mgst1 UTSW 6 138156331 missense probably damaging 1.00
R0730:Mgst1 UTSW 6 138147669 missense probably benign 0.03
R0862:Mgst1 UTSW 6 138147751 missense probably damaging 1.00
R4447:Mgst1 UTSW 6 138141664 intron probably benign
R4644:Mgst1 UTSW 6 138156370 missense probably damaging 1.00
R4701:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R4930:Mgst1 UTSW 6 138153509 missense probably benign 0.00
R5688:Mgst1 UTSW 6 138141800 intron probably benign
R6307:Mgst1 UTSW 6 138150829 missense probably benign 0.44
R6468:Mgst1 UTSW 6 138141587 unclassified probably null
R6697:Mgst1 UTSW 6 138147753 missense probably damaging 1.00
R6741:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R6755:Mgst1 UTSW 6 138147772 missense probably damaging 0.99
R6791:Mgst1 UTSW 6 138141807 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTCAAGCCACCCTTAGC -3'
(R):5'- ACCTCAGAAAGAGTTTGAATCCAC -3'

Sequencing Primer
(F):5'- AAGCCACCCTTAGCTAATCTTG -3'
(R):5'- CAGCCTGTAAGCCATTGA -3'
Posted On2015-09-24