Incidental Mutation 'R4569:2610021A01Rik'
ID342000
Institutional Source Beutler Lab
Gene Symbol 2610021A01Rik
Ensembl Gene ENSMUSG00000091474
Gene NameRIKEN cDNA 2610021A01 gene
Synonyms
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41599230-41628533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41625838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 322 (T322A)
Ref Sequence ENSEMBL: ENSMUSP00000127760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163475]
Predicted Effect probably benign
Transcript: ENSMUST00000163475
AA Change: T322A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127760
Gene: ENSMUSG00000091474
AA Change: T322A

DomainStartEndE-ValueType
KRAB 18 78 1.32e-32 SMART
ZnF_C2H2 415 437 4.54e-4 SMART
ZnF_C2H2 443 465 3.69e-4 SMART
ZnF_C2H2 471 493 5.14e-3 SMART
ZnF_C2H2 499 521 4.94e-5 SMART
ZnF_C2H2 527 549 3.16e-3 SMART
ZnF_C2H2 555 577 3.16e-3 SMART
ZnF_C2H2 583 605 8.6e-5 SMART
ZnF_C2H2 611 633 1.79e-2 SMART
ZnF_C2H2 639 661 2.43e-4 SMART
ZnF_C2H2 667 689 1.72e-4 SMART
ZnF_C2H2 695 717 9.73e-4 SMART
ZnF_C2H2 723 745 2.02e-1 SMART
ZnF_C2H2 751 773 1.69e-3 SMART
ZnF_C2H2 779 801 3.69e-4 SMART
ZnF_C2H2 807 829 7.37e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206757
Meta Mutation Damage Score 0.1248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in 2610021A01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:2610021A01Rik APN 7 41625572 missense possibly damaging 0.61
IGL00566:2610021A01Rik APN 7 41625391 missense possibly damaging 0.53
R0940:2610021A01Rik UTSW 7 41626434 missense probably damaging 1.00
R1101:2610021A01Rik UTSW 7 41627359 missense probably damaging 1.00
R1180:2610021A01Rik UTSW 7 41625717 missense probably benign 0.41
R1560:2610021A01Rik UTSW 7 41626042 missense probably benign 0.09
R1740:2610021A01Rik UTSW 7 41626125 nonsense probably null
R1988:2610021A01Rik UTSW 7 41626657 nonsense probably null
R2041:2610021A01Rik UTSW 7 41625979 missense possibly damaging 0.63
R2964:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2965:2610021A01Rik UTSW 7 41626405 nonsense probably null
R2966:2610021A01Rik UTSW 7 41626405 nonsense probably null
R4002:2610021A01Rik UTSW 7 41625540 missense possibly damaging 0.83
R4708:2610021A01Rik UTSW 7 41611885 missense probably damaging 1.00
R4880:2610021A01Rik UTSW 7 41627105 missense possibly damaging 0.47
R4933:2610021A01Rik UTSW 7 41626802 missense probably damaging 0.98
R5036:2610021A01Rik UTSW 7 41626154 missense possibly damaging 0.92
R5206:2610021A01Rik UTSW 7 41626585 nonsense probably null
R5235:2610021A01Rik UTSW 7 41624832 missense possibly damaging 0.53
R6449:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6488:2610021A01Rik UTSW 7 41625874 nonsense probably null
R6904:2610021A01Rik UTSW 7 41626092 nonsense probably null
X0067:2610021A01Rik UTSW 7 41627317 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAGAAGCTGTCCACAAGC -3'
(R):5'- TAAGTCTAGTGAGGCCTGAGG -3'

Sequencing Primer
(F):5'- GCAAATGAGTCCTCAAATTGTAGTC -3'
(R):5'- AGGAGTTCCTGGAGTATTTCCCAG -3'
Posted On2015-09-24