Incidental Mutation 'R4569:Vmn2r71'
ID342002
Institutional Source Beutler Lab
Gene Symbol Vmn2r71
Ensembl Gene ENSMUSG00000091205
Gene Namevomeronasal 2, receptor 71
SynonymsEG233445
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85574614-85624547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85624194 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 739 (K739Q)
Ref Sequence ENSEMBL: ENSMUSP00000132337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172338
AA Change: K739Q

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: K739Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.1e-31 PFAM
Pfam:NCD3G 511 563 8.7e-20 PFAM
Pfam:7tm_3 593 831 2e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208273
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Vmn2r71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Vmn2r71 APN 7 85618693 missense probably benign
IGL00960:Vmn2r71 APN 7 85624374 missense probably damaging 1.00
IGL01372:Vmn2r71 APN 7 85620814 splice site probably benign
IGL01690:Vmn2r71 APN 7 85615574 missense probably damaging 1.00
IGL01909:Vmn2r71 APN 7 85620793 missense probably benign 0.00
IGL01950:Vmn2r71 APN 7 85615619 missense probably damaging 0.98
IGL02570:Vmn2r71 APN 7 85615540 missense possibly damaging 0.95
IGL02650:Vmn2r71 APN 7 85624327 missense probably damaging 1.00
IGL02901:Vmn2r71 APN 7 85619262 missense probably benign 0.00
IGL03128:Vmn2r71 APN 7 85619587 missense probably damaging 1.00
IGL03328:Vmn2r71 APN 7 85624291 missense probably damaging 1.00
R0533:Vmn2r71 UTSW 7 85619218 frame shift probably null
R0707:Vmn2r71 UTSW 7 85619432 missense probably benign
R0841:Vmn2r71 UTSW 7 85618541 missense possibly damaging 0.62
R0865:Vmn2r71 UTSW 7 85619308 missense probably benign 0.01
R0883:Vmn2r71 UTSW 7 85623634 missense probably benign 0.19
R0939:Vmn2r71 UTSW 7 85623681 missense possibly damaging 0.70
R1597:Vmn2r71 UTSW 7 85624144 missense possibly damaging 0.46
R1646:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R1719:Vmn2r71 UTSW 7 85621227 missense probably damaging 1.00
R1860:Vmn2r71 UTSW 7 85615574 missense probably damaging 1.00
R2013:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2014:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2015:Vmn2r71 UTSW 7 85620637 missense probably benign 0.38
R2050:Vmn2r71 UTSW 7 85624473 missense probably damaging 1.00
R2084:Vmn2r71 UTSW 7 85618737 missense probably benign 0.03
R2221:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2223:Vmn2r71 UTSW 7 85624093 missense probably benign 0.40
R2245:Vmn2r71 UTSW 7 85624180 missense probably damaging 1.00
R3115:Vmn2r71 UTSW 7 85623658 missense probably damaging 0.97
R3122:Vmn2r71 UTSW 7 85615620 nonsense probably null
R3609:Vmn2r71 UTSW 7 85619662 missense probably damaging 1.00
R4093:Vmn2r71 UTSW 7 85621234 missense probably benign 0.00
R4305:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4306:Vmn2r71 UTSW 7 85624152 missense probably damaging 1.00
R4334:Vmn2r71 UTSW 7 85619834 missense probably benign 0.01
R4622:Vmn2r71 UTSW 7 85620609 missense probably benign 0.00
R4915:Vmn2r71 UTSW 7 85621268 missense probably damaging 0.99
R4956:Vmn2r71 UTSW 7 85619228 missense probably benign 0.19
R5005:Vmn2r71 UTSW 7 85624144 missense probably damaging 1.00
R5045:Vmn2r71 UTSW 7 85624389 missense probably benign 0.00
R5153:Vmn2r71 UTSW 7 85619222 missense possibly damaging 0.94
R5236:Vmn2r71 UTSW 7 85623669 missense probably damaging 1.00
R5373:Vmn2r71 UTSW 7 85618542 missense possibly damaging 0.79
R5405:Vmn2r71 UTSW 7 85619414 missense probably benign
R5831:Vmn2r71 UTSW 7 85623714 missense probably benign 0.16
R6061:Vmn2r71 UTSW 7 85619274 missense probably benign
R6518:Vmn2r71 UTSW 7 85621228 missense probably damaging 1.00
R6751:Vmn2r71 UTSW 7 85619887 critical splice donor site probably null
R6920:Vmn2r71 UTSW 7 85623900 missense probably damaging 1.00
X0025:Vmn2r71 UTSW 7 85618665 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCATTCAAGATAACTGTTCCAG -3'
(R):5'- TGCACTGGAGGCCAAGATAC -3'

Sequencing Primer
(F):5'- TTCAAGATAACTGTTCCAGGAAGAAG -3'
(R):5'- GACAGCCATAATCTTGCCTTTGGTG -3'
Posted On2015-09-24