Incidental Mutation 'R4570:Vmn2r6'
ID342061
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 041794-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R4570 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64559647 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 144 (W144R)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: W55R

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: W55R

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: W144R

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: W144R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Flt1 C T 5: 147,594,613 A847T probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 T3861K probably damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Nvl A G 1: 181,144,082 V9A probably benign Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scmh1 T A 4: 120,528,298 H623Q probably damaging Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5256:Vmn2r6 UTSW 3 64556842 missense probably benign 0.33
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCATCTCTATACCTCATAG -3'
(R):5'- TCCGCTGGATGAAAACCATG -3'

Sequencing Primer
(F):5'- TGAGTGCATAGAGATTCACCTGCC -3'
(R):5'- GCTGGATGAAAACCATGATCCAC -3'
Posted On2015-09-24