Incidental Mutation 'R4570:Mdn1'
ID342066
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 041794-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R4570 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32741812 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 3861 (T3861K)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: T3861K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: T3861K

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: T3861K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: T3861K

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Flt1 C T 5: 147,594,613 A847T probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Nvl A G 1: 181,144,082 V9A probably benign Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scmh1 T A 4: 120,528,298 H623Q probably damaging Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r6 A T 3: 64,559,647 W144R probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32730881 missense probably benign 0.17
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTACAGGTTTTATGTGGAAGTCGTC -3'
(R):5'- AGCTCCTGGCAAGTCATAGC -3'

Sequencing Primer
(F):5'- GTCGTCCCTCTAAACATAATTTTTGC -3'
(R):5'- CTGGCAAGTCATAGCTTCACAGTG -3'
Posted On2015-09-24