Incidental Mutation 'R4574:Adam1b'
ID342328
Institutional Source Beutler Lab
Gene Symbol Adam1b
Ensembl Gene ENSMUSG00000062438
Gene Namea disintegrin and metallopeptidase domain 1b
SynonymsPH-30 alpha, Ftna, fertilin alpha
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121500098-121503435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121500793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 730 (S730A)
Ref Sequence ENSEMBL: ENSMUSP00000078343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079368] [ENSMUST00000111795] [ENSMUST00000156080]
Predicted Effect probably benign
Transcript: ENSMUST00000079368
AA Change: S730A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078343
Gene: ENSMUSG00000062438
AA Change: S730A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 159 1.6e-18 PFAM
Pfam:Reprolysin_5 201 378 2.9e-15 PFAM
Pfam:Reprolysin_4 202 386 6.8e-9 PFAM
Pfam:Reprolysin 203 397 2.4e-70 PFAM
Pfam:Reprolysin_3 223 349 3.9e-14 PFAM
Pfam:Reprolysin_2 223 387 5.8e-9 PFAM
DISIN 415 488 8.08e-29 SMART
ACR 489 628 3.41e-47 SMART
EGF 634 665 2.34e1 SMART
transmembrane domain 705 727 N/A INTRINSIC
coiled coil region 763 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196484
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, healthy and fertile with no significant defects in sperm function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Cdk12 A G 11: 98,220,988 probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Myo5c A G 9: 75,269,611 I613V probably benign Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Sumf1 A G 6: 108,108,432 probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Tjp1 A G 7: 65,322,605 F604L probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Zfp592 A G 7: 81,023,786 D166G possibly damaging Het
Other mutations in Adam1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adam1b APN 5 121500993 missense probably damaging 0.96
IGL01696:Adam1b APN 5 121500793 missense possibly damaging 0.73
IGL01906:Adam1b APN 5 121501475 missense probably benign 0.00
IGL02003:Adam1b APN 5 121501291 missense probably damaging 1.00
IGL02438:Adam1b APN 5 121501038 missense probably damaging 1.00
IGL02479:Adam1b APN 5 121501398 missense probably damaging 1.00
IGL03258:Adam1b APN 5 121501384 missense possibly damaging 0.94
PIT4519001:Adam1b UTSW 5 121501947 missense probably damaging 1.00
R1695:Adam1b UTSW 5 121500907 missense probably benign 0.02
R1816:Adam1b UTSW 5 121501725 missense probably damaging 0.99
R1831:Adam1b UTSW 5 121502937 missense possibly damaging 0.67
R1833:Adam1b UTSW 5 121502937 missense possibly damaging 0.67
R1839:Adam1b UTSW 5 121501041 missense probably damaging 1.00
R2031:Adam1b UTSW 5 121501055 missense possibly damaging 0.73
R2110:Adam1b UTSW 5 121500714 intron probably benign
R2112:Adam1b UTSW 5 121500714 intron probably benign
R2570:Adam1b UTSW 5 121501748 missense probably damaging 1.00
R3020:Adam1b UTSW 5 121501383 missense possibly damaging 0.67
R4573:Adam1b UTSW 5 121500793 missense probably benign 0.18
R5023:Adam1b UTSW 5 121501159 missense probably damaging 1.00
R5364:Adam1b UTSW 5 121500883 missense possibly damaging 0.75
R6553:Adam1b UTSW 5 121501187 missense probably benign 0.05
R6585:Adam1b UTSW 5 121501187 missense probably benign 0.05
R6600:Adam1b UTSW 5 121501467 missense probably damaging 1.00
R7285:Adam1b UTSW 5 121500993 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCTCGGCTACTTATTGGC -3'
(R):5'- ACAGTGGCCCTGCTGTTAATC -3'

Sequencing Primer
(F):5'- AGGCTCGGCTACTTATTGGCTTTATC -3'
(R):5'- GGCCCTGCTGTTAATCTGTCAAATG -3'
Posted On2015-09-24