Incidental Mutation 'R4574:Myo5c'
ID342342
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75269611 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 613 (I613V)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: I613V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: I613V

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Cdk12 A G 11: 98,220,988 probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Sumf1 A G 6: 108,108,432 probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Tjp1 A G 7: 65,322,605 F604L probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Zfp592 A G 7: 81,023,786 D166G possibly damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCTCCCTATACAATGGTG -3'
(R):5'- AAGAGGCCTGTTGTCTGAAGC -3'

Sequencing Primer
(F):5'- TCACCTGAACCCTCTCATTGAGATAG -3'
(R):5'- TTGTCTGAAGCCAGGCCTG -3'
Posted On2015-09-24