Incidental Mutation 'R4574:Cdk12'
ID342348
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 041797-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4574 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 98220988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect probably benign
Transcript: ENSMUST00000003203
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107538
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107539
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145113
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T A 10: 43,533,010 S46C probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Adamts9 G A 6: 92,879,959 R319* probably null Het
Anapc1 G T 2: 128,627,195 S1575R probably damaging Het
Appbp2 A T 11: 85,209,938 probably null Het
Bcas2 C T 3: 103,174,350 P90S probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd101 T C 3: 101,013,153 N477D probably benign Het
Clcn4 T C 7: 7,287,805 E634G probably benign Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cpt1b G T 15: 89,424,044 probably null Het
Ctf2 T G 7: 127,719,384 T148P possibly damaging Het
Ddx23 G A 15: 98,647,624 T601I probably damaging Het
Dlx6 G T 6: 6,865,305 probably benign Het
Dmrtb1 A T 4: 107,677,068 N183K possibly damaging Het
Dnah11 A G 12: 118,012,255 probably null Het
Dnah5 C T 15: 28,367,763 P2765S probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Fpr-rs6 T A 17: 20,183,097 M1L probably damaging Het
Gm4841 T C 18: 60,269,926 N365S probably benign Het
Gsdmc2 C T 15: 63,828,023 probably null Het
Irx5 G A 8: 92,358,262 V27I probably damaging Het
Kmt2e T A 5: 23,492,407 V101D possibly damaging Het
Maip1 A C 1: 57,413,245 K219Q possibly damaging Het
Mpp7 G T 18: 7,353,228 R493S probably benign Het
Ms4a14 T C 19: 11,303,971 T408A probably benign Het
Mthfr A G 4: 148,043,541 N117S possibly damaging Het
Myo5c A G 9: 75,269,611 I613V probably benign Het
Neurl1b A G 17: 26,431,886 Q44R probably benign Het
Nup54 T A 5: 92,425,782 N187I probably benign Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr992 C A 2: 85,400,026 C169F probably damaging Het
Pate2 C A 9: 35,685,673 probably benign Het
Pccb T C 9: 100,985,199 S445G probably damaging Het
Pex3 G A 10: 13,535,571 Q188* probably null Het
Pikfyve T A 1: 65,192,192 W74R probably damaging Het
Plcl2 T C 17: 50,607,846 S628P probably damaging Het
Pnldc1 T C 17: 12,892,782 H346R probably benign Het
Pom121l2 T A 13: 21,984,402 C948S probably benign Het
Pspc1 A T 14: 56,761,947 M284K possibly damaging Het
Ralgapa2 A G 2: 146,435,999 L414S probably damaging Het
Rgs13 T A 1: 144,140,845 K53N probably damaging Het
Rorc T C 3: 94,388,984 S163P probably benign Het
Rpl3l A C 17: 24,734,010 T315P possibly damaging Het
Rsph3b A G 17: 6,905,039 V487A probably benign Het
Rusc2 A G 4: 43,416,080 E462G probably damaging Het
Sez6l T C 5: 112,428,478 T838A probably damaging Het
Slc22a14 A G 9: 119,179,495 Y236H probably damaging Het
Sspo G A 6: 48,465,523 R1984H probably damaging Het
Steap3 G T 1: 120,241,456 D370E probably benign Het
Sumf1 A G 6: 108,108,432 probably benign Het
Telo2 T C 17: 25,101,673 E754G probably damaging Het
Tjp1 A G 7: 65,322,605 F604L probably damaging Het
Trpm7 A T 2: 126,797,211 D1734E probably benign Het
Tsfm A C 10: 127,028,373 Y158D probably damaging Het
Ubtf T C 11: 102,306,765 probably benign Het
Upk3a G T 15: 85,020,551 V167F possibly damaging Het
Vmn2r19 C T 6: 123,315,980 S327L probably benign Het
Vps13c T A 9: 67,951,683 I2805N probably damaging Het
Zfp592 A G 7: 81,023,786 D166G possibly damaging Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R2570:Cdk12 UTSW 11 98203792 missense possibly damaging 0.94
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense not run
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTAGTGAACACTTACACACCTCTC -3'
(R):5'- GATGGCCAATTTATTCTTTTGGAAC -3'

Sequencing Primer
(F):5'- CCACTACCTTGTACCTTTGAAGC -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2015-09-24