Incidental Mutation 'R4575:Ago3'
ID342384
Institutional Source Beutler Lab
Gene Symbol Ago3
Ensembl Gene ENSMUSG00000028842
Gene Nameargonaute RISC catalytic subunit 3
SynonymseIF2C3, argonaute 3, C130014L07Rik
MMRRC Submission 041798-MU
Accession Numbers

Genbank: NM_153402; MGI: 2446634

Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126331704-126429556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126346682 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 129 (H129R)
Ref Sequence ENSEMBL: ENSMUSP00000116204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069097] [ENSMUST00000127831] [ENSMUST00000132123]
Predicted Effect probably benign
Transcript: ENSMUST00000069097
AA Change: H808R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066633
Gene: ENSMUSG00000028842
AA Change: H808R

DomainStartEndE-ValueType
Pfam:ArgoN 20 167 9.4e-26 PFAM
DUF1785 176 228 3.48e-25 SMART
PAZ 236 371 4.18e-4 SMART
Pfam:ArgoL2 376 421 1.3e-14 PFAM
Pfam:ArgoMid 430 512 1.4e-34 PFAM
Piwi 518 819 2.96e-136 SMART
Blast:Piwi 826 852 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127831
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118577
Gene: ENSMUSG00000028842
AA Change: T126A

DomainStartEndE-ValueType
Piwi 1 125 9.56e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132123
AA Change: H129R

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116204
Gene: ENSMUSG00000028842
AA Change: H129R

DomainStartEndE-ValueType
Piwi 1 140 1.41e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is highly basic, contains a PAZ domain and a PIWI domain, and may play a role in short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a tandem cluster of closely related family members including argonaute 4 and eukaryotic translation initiation factor 2C, 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(22) : Gene trapped(22)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Ago3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ago3 APN 4 126371541 missense probably damaging 1.00
IGL01826:Ago3 APN 4 126403282 missense probably damaging 1.00
IGL02285:Ago3 APN 4 126350877 missense possibly damaging 0.88
IGL02869:Ago3 APN 4 126367787 splice site probably benign
IGL03068:Ago3 APN 4 126417378 missense probably damaging 0.99
D4043:Ago3 UTSW 4 126351003 missense probably damaging 1.00
R0506:Ago3 UTSW 4 126417252 missense possibly damaging 0.79
R0545:Ago3 UTSW 4 126417232 missense probably damaging 1.00
R0764:Ago3 UTSW 4 126355092 missense possibly damaging 0.82
R1445:Ago3 UTSW 4 126371787 missense probably benign
R1706:Ago3 UTSW 4 126370292 missense probably damaging 1.00
R1909:Ago3 UTSW 4 126346737 missense probably damaging 1.00
R1944:Ago3 UTSW 4 126353727 missense probably damaging 1.00
R1974:Ago3 UTSW 4 126346751 missense probably damaging 1.00
R2239:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2380:Ago3 UTSW 4 126368522 missense probably damaging 1.00
R2424:Ago3 UTSW 4 126404247 missense probably damaging 1.00
R2571:Ago3 UTSW 4 126363811 missense probably damaging 1.00
R3121:Ago3 UTSW 4 126417372 missense probably benign
R3122:Ago3 UTSW 4 126417372 missense probably benign
R4022:Ago3 UTSW 4 126368593 missense probably benign 0.31
R4079:Ago3 UTSW 4 126353680 critical splice donor site probably null
R4272:Ago3 UTSW 4 126355091 missense possibly damaging 0.95
R4533:Ago3 UTSW 4 126345563 missense probably damaging 1.00
R4656:Ago3 UTSW 4 126363752 nonsense probably null
R4782:Ago3 UTSW 4 126347872 splice site probably null
R4783:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4784:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4785:Ago3 UTSW 4 126368503 missense probably benign 0.31
R4799:Ago3 UTSW 4 126347872 splice site probably null
R5013:Ago3 UTSW 4 126368598 missense probably benign 0.18
R5180:Ago3 UTSW 4 126367751 missense probably benign 0.01
R5692:Ago3 UTSW 4 126355069 unclassified probably null
R5801:Ago3 UTSW 4 126371768 missense possibly damaging 0.53
R5955:Ago3 UTSW 4 126355050 missense probably damaging 1.00
R6730:Ago3 UTSW 4 126371545 missense probably null 0.04
T0722:Ago3 UTSW 4 126404263 missense probably benign
T0722:Ago3 UTSW 4 126404296 missense probably benign 0.21
T0722:Ago3 UTSW 4 126404305 missense probably benign
T0722:Ago3 UTSW 4 126404310 missense probably benign 0.00
T0975:Ago3 UTSW 4 126404263 missense probably benign
T0975:Ago3 UTSW 4 126404305 missense probably benign
T0975:Ago3 UTSW 4 126404310 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGGATTTGGTTTAAGAATCCCCAC -3'
(R):5'- AGAGTATACCATTTCCTCTCCATAGG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GGTACCAGCCGTCCTTCACAC -3'
Posted On2015-09-24