Incidental Mutation 'R4575:Traf3ip2'
ID342411
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene NameTRAF3 interacting protein 2
SynonymsAct1
MMRRC Submission 041798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4575 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39612934-39655307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39634654 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 308 (N308D)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
Predicted Effect probably damaging
Transcript: ENSMUST00000019987
AA Change: N308D

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: N308D

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153261
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik C T 7: 131,362,596 A26T probably benign Het
4930408O17Rik C A 12: 104,871,268 noncoding transcript Het
Adgrf3 T A 5: 30,202,257 M224L probably benign Het
Ago3 T C 4: 126,346,682 H129R probably benign Het
Asb10 C T 5: 24,540,054 R99H probably damaging Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
Ccdc96 T C 5: 36,486,075 V475A possibly damaging Het
Clec4b2 T A 6: 123,173,680 L16Q probably damaging Het
Cyp2c68 T A 19: 39,734,361 I248L probably benign Het
Cyp2d22 G T 15: 82,371,932 A167E possibly damaging Het
Doxl2 C T 6: 48,977,568 Q547* probably null Het
Dpysl3 T C 18: 43,342,247 K382R probably damaging Het
Dscam A G 16: 96,825,623 I362T possibly damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgd4 T C 16: 16,437,032 Q507R probably damaging Het
Frem3 A G 8: 80,616,075 T1666A probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Gabrr1 C T 4: 33,158,175 T266I possibly damaging Het
Gm11563 G A 11: 99,658,449 P160S unknown Het
Gm12166 T C 11: 46,051,852 D148G probably damaging Het
Gm12790 T C 4: 101,968,127 D30G probably benign Het
Haus8 A G 8: 71,263,092 V34A probably damaging Het
Hgf T C 5: 16,572,601 Y199H probably benign Het
Ide G A 19: 37,272,205 P916L unknown Het
Igsf10 G T 3: 59,330,100 H887N probably benign Het
Iigp1 A T 18: 60,390,146 H112L probably benign Het
Impg2 A G 16: 56,261,732 E1009G probably damaging Het
Khdc1a A C 1: 21,350,429 D91A probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Kprp T C 3: 92,823,964 N593S probably benign Het
Krt2 T G 15: 101,814,486 D359A probably damaging Het
Krt35 A T 11: 100,095,899 N96K probably benign Het
Lnx1 T C 5: 74,685,543 D82G probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nfib A T 4: 82,296,811 S518R probably damaging Het
Nol6 T C 4: 41,120,299 I473V probably benign Het
Obscn T C 11: 59,122,772 D1108G probably damaging Het
Olfr553 A T 7: 102,614,769 C73* probably null Het
Olfr834 C A 9: 18,988,705 S239* probably null Het
Otop1 T C 5: 38,299,721 Y275H probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Prr14l T C 5: 32,793,644 E1935G probably damaging Het
Ptprd C T 4: 76,243,786 V78I possibly damaging Het
Rfc4 T A 16: 23,114,429 probably benign Het
Rpn2 C A 2: 157,295,324 A209E probably damaging Het
Sf1 T C 19: 6,375,913 probably benign Het
Skint5 T A 4: 113,667,193 S864C unknown Het
Slc2a10 C G 2: 165,516,321 N455K probably damaging Het
Snrnp200 T A 2: 127,235,066 I1673N probably benign Het
Sri G T 5: 8,063,693 G152W probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Uhrf1bp1 T C 17: 27,887,503 V1001A probably benign Het
Vmn2r125 T A 4: 156,349,977 D19E probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39634660 missense probably benign
IGL02097:Traf3ip2 APN 10 39654479 missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39646906 missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39654410 missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39626219 missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39639222 missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39645708 missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39634673 missense probably damaging 0.96
R1282:Traf3ip2 UTSW 10 39626405 missense probably damaging 1.00
R1913:Traf3ip2 UTSW 10 39625940 missense probably benign 0.00
R2975:Traf3ip2 UTSW 10 39626540 missense probably benign 0.00
R4576:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4681:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39645739 missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39626100 missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39626477 missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39641341 missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39639404 splice site probably null
R6462:Traf3ip2 UTSW 10 39639247 missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39626177 missense possibly damaging 0.61
X0020:Traf3ip2 UTSW 10 39654519 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTGTTCAGCGAGCTTGC -3'
(R):5'- ACTGAGCATCTCACTGTGGC -3'

Sequencing Primer
(F):5'- CATGTCTTTCGCATGAAGTAGC -3'
(R):5'- ATCTCACTGTGGCTGCGC -3'
Posted On2015-09-24