Incidental Mutation 'R4576:Enah'
ID342438
Institutional Source Beutler Lab
Gene Symbol Enah
Ensembl Gene ENSMUSG00000022995
Gene NameENAH actin regulator
SynonymsNdpp1, Mena
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R4576 (G1)
Quality Score141
Status Not validated
Chromosome1
Chromosomal Location181896384-182019990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181919563 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 298 (S298L)
Ref Sequence ENSEMBL: ENSMUSP00000106654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078719] [ENSMUST00000111024] [ENSMUST00000111025] [ENSMUST00000111030] [ENSMUST00000177811] [ENSMUST00000192967] [ENSMUST00000193074] [ENSMUST00000193703] [ENSMUST00000195059]
Predicted Effect unknown
Transcript: ENSMUST00000078719
AA Change: S561L
SMART Domains Protein: ENSMUSP00000077781
Gene: ENSMUSG00000022995
AA Change: S561L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 154 258 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
low complexity region 308 317 N/A INTRINSIC
internal_repeat_1 354 366 4.73e-6 PROSPERO
low complexity region 373 392 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
low complexity region 430 471 N/A INTRINSIC
low complexity region 487 507 N/A INTRINSIC
low complexity region 542 609 N/A INTRINSIC
low complexity region 665 678 N/A INTRINSIC
internal_repeat_1 746 758 4.73e-6 PROSPERO
Pfam:VASP_tetra 765 801 1.7e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111024
AA Change: S298L
SMART Domains Protein: ENSMUSP00000106653
Gene: ENSMUSG00000022995
AA Change: S298L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111025
AA Change: S298L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106654
Gene: ENSMUSG00000022995
AA Change: S298L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 313 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
Pfam:VASP_tetra 467 506 2.3e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000111030
AA Change: S546L
SMART Domains Protein: ENSMUSP00000106659
Gene: ENSMUSG00000022995
AA Change: S546L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 3.87e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 3.87e-6 PROSPERO
Pfam:VASP_tetra 749 788 1.4e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177811
AA Change: S546L
SMART Domains Protein: ENSMUSP00000136863
Gene: ENSMUSG00000022995
AA Change: S546L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 4.25e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 4.25e-6 PROSPERO
Pfam:VASP_tetra 749 788 2.2e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000192967
AA Change: S192L
SMART Domains Protein: ENSMUSP00000141330
Gene: ENSMUSG00000022995
AA Change: S192L

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 63 1e-3 SMART
low complexity region 70 99 N/A INTRINSIC
low complexity region 118 138 N/A INTRINSIC
low complexity region 173 229 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000193074
AA Change: S281L
SMART Domains Protein: ENSMUSP00000141936
Gene: ENSMUSG00000022995
AA Change: S281L

DomainStartEndE-ValueType
RanBD 7 127 1.5e-4 SMART
WH1 21 128 2.8e-47 SMART
coiled coil region 155 260 N/A INTRINSIC
low complexity region 262 329 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
Pfam:VASP_tetra 484 523 1.8e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000193703
AA Change: S298L
SMART Domains Protein: ENSMUSP00000141462
Gene: ENSMUSG00000022995
AA Change: S298L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 346 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Pfam:VASP_tetra 501 540 2.5e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000195059
AA Change: S542L
SMART Domains Protein: ENSMUSP00000141344
Gene: ENSMUSG00000022995
AA Change: S542L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted mutation show defects in major axonal projection pathways in brain, including malformation of the hippocampal commissure and pontocerebellar fibers and frequent agenesis of the corpus callosum due to a failure of axons to project across the midline during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Enah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Enah APN 1 181935696 intron probably benign
IGL01996:Enah APN 1 181956505 missense unknown
R0025:Enah UTSW 1 181913373 missense possibly damaging 0.53
R0612:Enah UTSW 1 181906448 splice site probably benign
R1005:Enah UTSW 1 181961930 splice site probably benign
R1075:Enah UTSW 1 181956501 missense unknown
R1589:Enah UTSW 1 181922293 missense probably damaging 1.00
R1601:Enah UTSW 1 181919620 nonsense probably null
R1607:Enah UTSW 1 181917197 critical splice donor site probably null
R1785:Enah UTSW 1 181956429 missense unknown
R2035:Enah UTSW 1 181921972 missense probably damaging 1.00
R2037:Enah UTSW 1 181921972 missense probably damaging 1.00
R2119:Enah UTSW 1 181921753 missense probably damaging 0.98
R2180:Enah UTSW 1 181918459 missense probably damaging 1.00
R2233:Enah UTSW 1 181921972 missense probably damaging 1.00
R4348:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4350:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4956:Enah UTSW 1 181918289 missense probably damaging 0.98
R5230:Enah UTSW 1 181935670 intron probably benign
R5282:Enah UTSW 1 181935728 splice site probably null
R5505:Enah UTSW 1 181906453 splice site probably benign
R5813:Enah UTSW 1 181931185 intron probably benign
R6324:Enah UTSW 1 181918571 missense probably damaging 1.00
R6374:Enah UTSW 1 181923580 missense unknown
R6503:Enah UTSW 1 181918511 missense probably damaging 1.00
R6513:Enah UTSW 1 182014355 intron probably benign
R6925:Enah UTSW 1 181905898 critical splice acceptor site probably null
R6925:Enah UTSW 1 181905899 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCGGGACACTTTCCTAAG -3'
(R):5'- TCTGAGTCACTTACTTGAGCATG -3'

Sequencing Primer
(F):5'- CAAGTCCAGTTAAAGGGCGATTGTC -3'
(R):5'- GAGTCACTTACTTGAGCATGGCATTC -3'
Posted On2015-09-24