Incidental Mutation 'R4576:Svop'
ID342459
Institutional Source Beutler Lab
Gene Symbol Svop
Ensembl Gene ENSMUSG00000042078
Gene NameSV2 related protein
Synonyms1110030H18Rik, msvop
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4576 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114026910-114091570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114065682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 13 (V13M)
Ref Sequence ENSEMBL: ENSMUSP00000117724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058472] [ENSMUST00000150106] [ENSMUST00000202603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058472
AA Change: V14M

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050730
Gene: ENSMUSG00000042078
AA Change: V14M

DomainStartEndE-ValueType
Pfam:Sugar_tr 66 347 2.2e-26 PFAM
Pfam:MFS_1 86 346 2e-23 PFAM
Pfam:MFS_1 376 541 2.5e-16 PFAM
Pfam:Sugar_tr 377 523 2.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140151
Predicted Effect probably damaging
Transcript: ENSMUST00000150106
AA Change: V13M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117724
Gene: ENSMUSG00000042078
AA Change: V13M

DomainStartEndE-ValueType
transmembrane domain 85 107 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 154 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162506
Predicted Effect probably benign
Transcript: ENSMUST00000202603
SMART Domains Protein: ENSMUSP00000144522
Gene: ENSMUSG00000029592

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:UCH 51 144 5.8e-11 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable with no phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Svop
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Svop APN 5 114065528 missense probably benign 0.02
IGL02612:Svop APN 5 114028260 makesense probably null
R0254:Svop UTSW 5 114038539 missense probably benign
R1705:Svop UTSW 5 114042295 missense probably damaging 1.00
R1826:Svop UTSW 5 114060056 critical splice donor site probably null
R3084:Svop UTSW 5 114042238 missense probably benign
R4494:Svop UTSW 5 114045627 missense probably damaging 0.99
R4575:Svop UTSW 5 114065682 missense probably damaging 1.00
R4578:Svop UTSW 5 114065682 missense probably damaging 1.00
R4725:Svop UTSW 5 114065485 unclassified probably benign
R5433:Svop UTSW 5 114060125 missense probably damaging 1.00
R5731:Svop UTSW 5 114060063 missense probably damaging 0.99
R5783:Svop UTSW 5 114064935 missense possibly damaging 0.73
R5889:Svop UTSW 5 114065631 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGAACTTTCTACCACCAGGGC -3'
(R):5'- GGTTCTGTGCAGAGTCCAAC -3'

Sequencing Primer
(F):5'- AGGGCTTTTCTCACCATCAG -3'
(R):5'- CGTCCAACTGTCAACTGATCAG -3'
Posted On2015-09-24