Incidental Mutation 'R4576:Exoc7'
ID342487
Institutional Source Beutler Lab
Gene Symbol Exoc7
Ensembl Gene ENSMUSG00000020792
Gene Nameexocyst complex component 7
Synonymssec70, Exo70, 70kDa
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R4576 (G1)
Quality Score223
Status Validated
Chromosome11
Chromosomal Location116288001-116307233 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 116289183 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 685 (*685W)
Ref Sequence ENSEMBL: ENSMUSP00000102021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000106411] [ENSMUST00000106413]
Predicted Effect probably null
Transcript: ENSMUST00000021147
AA Change: *698W
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792
AA Change: *698W

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106411
AA Change: *654W
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792
AA Change: *654W

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106413
AA Change: *685W
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792
AA Change: *685W

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155288
Meta Mutation Damage Score 0.658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Slitrk6 C A 14: 110,750,170 V702F probably benign Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Exoc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Exoc7 APN 11 116301100 splice site probably null
IGL02825:Exoc7 APN 11 116297585 missense probably damaging 0.98
IGL03068:Exoc7 APN 11 116301134 missense possibly damaging 0.70
IGL03333:Exoc7 APN 11 116301161 missense probably benign 0.17
IGL03412:Exoc7 APN 11 116289275 missense possibly damaging 0.57
IGL02799:Exoc7 UTSW 11 116301181 missense probably damaging 1.00
R0022:Exoc7 UTSW 11 116297582 missense possibly damaging 0.62
R0068:Exoc7 UTSW 11 116304906 missense probably damaging 1.00
R0158:Exoc7 UTSW 11 116295292 missense probably benign 0.01
R0362:Exoc7 UTSW 11 116295662 missense probably benign 0.37
R0387:Exoc7 UTSW 11 116294401 unclassified probably benign
R0394:Exoc7 UTSW 11 116300398 missense probably damaging 0.99
R0714:Exoc7 UTSW 11 116293294 missense probably benign 0.16
R0848:Exoc7 UTSW 11 116295248 missense possibly damaging 0.93
R1611:Exoc7 UTSW 11 116295265 missense possibly damaging 0.84
R1795:Exoc7 UTSW 11 116292521 missense probably damaging 0.98
R2259:Exoc7 UTSW 11 116306411 missense probably damaging 1.00
R3911:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3913:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3979:Exoc7 UTSW 11 116296762 missense probably benign 0.30
R4029:Exoc7 UTSW 11 116306988 unclassified probably benign
R4983:Exoc7 UTSW 11 116289269 missense probably damaging 1.00
R5309:Exoc7 UTSW 11 116305027 nonsense probably null
R6453:Exoc7 UTSW 11 116293969 splice site probably null
X0063:Exoc7 UTSW 11 116304949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTGGTGTGCAGATGAAG -3'
(R):5'- CTTTGGGACTTTTACTCAGGCC -3'

Sequencing Primer
(F):5'- CAGATGAAGGCTGCAGGG -3'
(R):5'- CCATCTTAGCGCCTGGC -3'
Posted On2015-09-24