Incidental Mutation 'R4576:Slitrk6'
ID342498
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene NameSLIT and NTRK-like family, member 6
Synonyms4832410J21Rik
MMRRC Submission 041799-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R4576 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location110748580-110755149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110750170 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 702 (V702F)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
Predicted Effect probably benign
Transcript: ENSMUST00000078386
AA Change: V702F

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: V702F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Adhfe1 A T 1: 9,553,754 D160V probably damaging Het
AI314180 A T 4: 58,834,708 probably benign Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Atp4a A G 7: 30,717,722 D510G probably benign Het
Atp8a1 T C 5: 67,815,815 probably benign Het
Auts2 C T 5: 132,258,934 G70E probably benign Het
C7 A G 15: 5,002,756 S658P probably damaging Het
Cdh9 T C 15: 16,832,239 V404A possibly damaging Het
Cfap54 C T 10: 93,043,228 probably null Het
Chml G T 1: 175,686,940 Q129K probably damaging Het
Chst2 T C 9: 95,405,171 H374R probably damaging Het
Cirbp A G 10: 80,170,241 K84E probably damaging Het
Cln6 G T 9: 62,838,949 Q23H probably benign Het
Cntn5 A G 9: 9,673,292 M801T probably benign Het
Dapk1 A T 13: 60,721,822 M293L probably benign Het
Ddx11 A G 17: 66,150,726 K869E probably damaging Het
Ddx17 A T 15: 79,541,146 M108K probably benign Het
Dnaaf5 C A 5: 139,185,639 A557D probably damaging Het
Edil3 T C 13: 89,319,731 Y452H probably damaging Het
Elfn1 T C 5: 139,972,053 S271P probably benign Het
Enah G A 1: 181,919,563 S298L possibly damaging Het
Exoc7 T C 11: 116,289,183 *685W probably null Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Fgfbp1 C T 5: 43,979,464 R162H probably benign Het
Foxj3 A G 4: 119,621,663 S439G unknown Het
Fzd9 A G 5: 135,250,312 S240P probably damaging Het
Gin1 A G 1: 97,792,339 D442G probably damaging Het
Gm10804 C T 2: 93,468,669 noncoding transcript Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl3 G T 4: 135,561,251 T41K probably damaging Het
H6pd A T 4: 149,994,476 D243E probably damaging Het
Heatr6 T A 11: 83,765,000 S306T probably benign Het
Hkdc1 T C 10: 62,385,843 D812G possibly damaging Het
Hmcn1 G T 1: 150,734,487 T1477K probably benign Het
Ift80 A G 3: 68,950,530 S261P possibly damaging Het
Kcnu1 A T 8: 25,890,020 D424V probably benign Het
Kctd1 A G 18: 15,007,700 S658P probably damaging Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
Kntc1 T G 5: 123,765,955 L345R probably damaging Het
Llph-ps2 A G X: 13,218,451 noncoding transcript Het
Lpxn T C 19: 12,833,290 I366T probably benign Het
Lrp1 ACAGGCGC AC 10: 127,540,188 probably benign Het
Maml3 G A 3: 51,856,506 Q346* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mlc1 G A 15: 88,974,537 T136M probably damaging Het
Pcdhga9 A C 18: 37,737,828 N237H probably damaging Het
Pde4dip C A 3: 97,754,249 E657D probably damaging Het
Pknox2 A G 9: 36,923,548 probably benign Het
Plcb3 C T 19: 6,959,047 probably benign Het
Plxnd1 G A 6: 115,968,044 A99V probably benign Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Ppp1r14c G T 10: 3,366,912 K82N probably damaging Het
Pum3 G A 19: 27,415,908 T389M probably benign Het
Pxdn A T 12: 30,011,923 T1165S probably benign Het
Rasgrf2 T C 13: 91,896,410 D925G possibly damaging Het
Samhd1 A T 2: 157,101,750 C615S probably damaging Het
Sec16a A T 2: 26,431,119 Y1320* probably null Het
Slco6b1 T A 1: 96,988,697 noncoding transcript Het
Spata31d1b C A 13: 59,716,861 H608N probably damaging Het
Srpr T C 9: 35,214,608 I394T possibly damaging Het
Svop C T 5: 114,065,682 V13M probably damaging Het
Tacc3 T A 5: 33,661,497 probably benign Het
Tango2 A T 16: 18,301,528 D146E probably damaging Het
Thbs1 G A 2: 118,119,416 R624Q probably damaging Het
Tmem161a T C 8: 70,182,063 probably null Het
Tmem175 A G 5: 108,644,602 D248G possibly damaging Het
Traf3ip2 A G 10: 39,634,654 N308D probably damaging Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Trip11 G A 12: 101,886,240 Q521* probably null Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Ttc16 A T 2: 32,770,059 F246I probably benign Het
Unc79 T C 12: 103,001,803 probably benign Het
Vmn1r74 A G 7: 11,846,769 probably null Het
Vmn2r16 A T 5: 109,363,799 Y624F possibly damaging Het
Zc3h4 G A 7: 16,434,654 R896H unknown Het
Zfp941 T A 7: 140,811,590 K619* probably null Het
Zfp970 A T 2: 177,475,680 H349L probably damaging Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110751115 missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110751576 missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110750074 missense probably benign
IGL01295:Slitrk6 APN 14 110751436 missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110751624 missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110751817 missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110749794 missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110749941 missense probably benign
PIT1430001:Slitrk6 UTSW 14 110750427 missense possibly damaging 0.93
R0035:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110751963 missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110752293 start gained probably benign
R0454:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110751885 missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110749819 missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110750098 missense probably benign
R1298:Slitrk6 UTSW 14 110751865 missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110750928 missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110750552 missense probably benign
R1998:Slitrk6 UTSW 14 110751823 missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110751955 missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110750272 missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110751388 missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110750148 missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110750739 missense probably damaging 1.00
R4856:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110750379 missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110749753 makesense probably null
R5281:Slitrk6 UTSW 14 110750373 missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110750097 missense probably benign
R5579:Slitrk6 UTSW 14 110751217 missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110752126 missense probably benign
R5935:Slitrk6 UTSW 14 110749873 missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110750526 missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110750247 missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110751096 nonsense probably null
R6952:Slitrk6 UTSW 14 110750542 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAAGTTGCTGAAGTTCCC -3'
(R):5'- CTATTGTATTCTGTGCCGCG -3'

Sequencing Primer
(F):5'- GAAGTTCCCTCTCTTTCTCCAAAATG -3'
(R):5'- ATTCTGTGCCGCGGGGATC -3'
Posted On2015-09-24