Incidental Mutation 'R4589:Ada'
ID342657
Institutional Source Beutler Lab
Gene Symbol Ada
Ensembl Gene ENSMUSG00000017697
Gene Nameadenosine deaminase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location163726584-163750239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 163732948 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 90 (K90E)
Ref Sequence ENSEMBL: ENSMUSP00000017841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017841]
PDB Structure
ADA STRUCTURE COMPLEXED WITH DEOXYCOFORMYCIN AT PH 7.0 [X-RAY DIFFRACTION]
ADA STRUCTURE COMPLEXED WITH PURINE RIBOSIDE AT PH 7.0 [X-RAY DIFFRACTION]
A PRE-TRANSITION STATE MIMIC OF AN ENZYME: X-RAY STRUCTURE OF ADENOSINE DEAMINASE WITH BOUND 1-DEAZA-ADENOSINE AND ZINC-ACTIVATED WATER [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D295E) [X-RAY DIFFRACTION]
MURINE ADENOSINE DEAMINASE (D296A) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 ALA MUTANT) [X-RAY DIFFRACTION]
ADENOSINE DEAMINASE (HIS 238 GLU MUTANT) [X-RAY DIFFRACTION]
ATOMIC STRUCTURE OF ADENOSINE DEAMINASE COMPLEXED WITH A TRANSITION-STATE ANALOG: UNDERSTANDING CATALYSIS AND IMMUNODEFICIENCY MUTATIONS [X-RAY DIFFRACTION]
Crystal structuore of adenosine deaminase from mus musculus complexed with 9-deazainosine [X-RAY DIFFRACTION]
Crystal structure of holo mADA at 1.6 A resolution [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000017841
AA Change: K90E

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017841
Gene: ENSMUSG00000017697
AA Change: K90E

DomainStartEndE-ValueType
Pfam:A_deaminase 8 346 1.3e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156939
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene die perinatally with defective purine metabolism and severe liver cell degeneration, but lack thymic abnormalities. Replacement of placental ADA can rescue ADA-deficient fetuses, resulting in mice that are T and B-cell deficient, have elevated dATP levels, and immune deficiencies resembling human ADA deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Ada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Ada APN 2 163730316 missense probably benign 0.02
IGL02414:Ada APN 2 163730040 missense probably benign
IGL02973:Ada APN 2 163731133 missense probably benign 0.01
R0053:Ada UTSW 2 163732292 missense probably damaging 0.99
R0076:Ada UTSW 2 163727603 unclassified probably benign
R0305:Ada UTSW 2 163728157 missense probably benign 0.00
R0463:Ada UTSW 2 163730351 missense probably benign 0.00
R0464:Ada UTSW 2 163732964 nonsense probably null
R0701:Ada UTSW 2 163730075 missense probably benign 0.30
R1474:Ada UTSW 2 163732894 missense possibly damaging 0.94
R4044:Ada UTSW 2 163735460 missense probably damaging 0.96
R5114:Ada UTSW 2 163730486 missense probably benign 0.15
R5424:Ada UTSW 2 163728125 nonsense probably null
R5753:Ada UTSW 2 163735398 missense probably benign 0.00
R6392:Ada UTSW 2 163728217 missense probably damaging 1.00
R6501:Ada UTSW 2 163728188 unclassified probably null
R6646:Ada UTSW 2 163735423 missense probably benign
Z1088:Ada UTSW 2 163728116 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAGTCGCTCTGAGTCCATG -3'
(R):5'- TAGTTCAAACGTACAGCTTCCC -3'

Sequencing Primer
(F):5'- TCTGAGTCCATGGACCAGG -3'
(R):5'- AAACGTACAGCTTCCCGGGAG -3'
Posted On2015-09-24