Incidental Mutation 'R4590:Frmd5'
ID342730
Institutional Source Beutler Lab
Gene Symbol Frmd5
Ensembl Gene ENSMUSG00000027238
Gene NameFERM domain containing 5
SynonymsA930004K21Rik, 1500032A09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121545529-121807087 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 121765031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110592] [ENSMUST00000110593] [ENSMUST00000121219] [ENSMUST00000128428] [ENSMUST00000138157] [ENSMUST00000145075] [ENSMUST00000155570]
Predicted Effect probably benign
Transcript: ENSMUST00000110592
SMART Domains Protein: ENSMUSP00000106222
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110593
SMART Domains Protein: ENSMUSP00000106223
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
low complexity region 489 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121219
SMART Domains Protein: ENSMUSP00000113568
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 1 121 1.92e-4 SMART
FERM_C 125 213 6.86e-24 SMART
FA 219 265 1.45e-13 SMART
low complexity region 363 385 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128428
SMART Domains Protein: ENSMUSP00000116468
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 202 3.21e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138157
SMART Domains Protein: ENSMUSP00000115136
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142016
Predicted Effect probably benign
Transcript: ENSMUST00000145075
SMART Domains Protein: ENSMUSP00000122195
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
SCOP:d1gg3a3 19 37 6e-5 SMART
low complexity region 71 93 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155570
SMART Domains Protein: ENSMUSP00000120176
Gene: ENSMUSG00000027238

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Frmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03025:Frmd5 APN 2 121553344 missense probably benign
big_rip UTSW 2 121549218 nonsense probably null
PIT4812001:Frmd5 UTSW 2 121586446 missense probably benign 0.34
R0385:Frmd5 UTSW 2 121555574 missense probably damaging 1.00
R1667:Frmd5 UTSW 2 121548730 frame shift probably null
R4243:Frmd5 UTSW 2 121562882 splice site probably null
R4705:Frmd5 UTSW 2 121562863 intron probably benign
R4909:Frmd5 UTSW 2 121591653 splice site probably null
R4935:Frmd5 UTSW 2 121562924 missense possibly damaging 0.75
R5008:Frmd5 UTSW 2 121548860 missense probably damaging 1.00
R5095:Frmd5 UTSW 2 121548921 missense possibly damaging 0.95
R5431:Frmd5 UTSW 2 121562909 missense probably damaging 1.00
R5875:Frmd5 UTSW 2 121558478 intron probably benign
R6246:Frmd5 UTSW 2 121551048 missense possibly damaging 0.66
R6404:Frmd5 UTSW 2 121549218 nonsense probably null
R7039:Frmd5 UTSW 2 121547647 unclassified probably benign
R7072:Frmd5 UTSW 2 121557870 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGCCCATTGTCCTTGTCTG -3'
(R):5'- CCCCGTAGAGGCTGTAGTAATTAAG -3'

Sequencing Primer
(F):5'- GCGGTGACCTTTCCCATG -3'
(R):5'- ACTAAGTGGTTTGTGAGGATTTAAG -3'
Posted On2015-09-24