Incidental Mutation 'R4590:Fgr'
ID342734
Institutional Source Beutler Lab
Gene Symbol Fgr
Ensembl Gene ENSMUSG00000028874
Gene NameFGR proto-oncogene, Src family tyrosine kinase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location132974095-133001910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132995053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 211 (V211E)
Ref Sequence ENSEMBL: ENSMUSP00000128411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030693] [ENSMUST00000171223]
Predicted Effect probably damaging
Transcript: ENSMUST00000030693
AA Change: V211E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030693
Gene: ENSMUSG00000028874
AA Change: V211E

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138179
Predicted Effect probably damaging
Transcript: ENSMUST00000171223
AA Change: V211E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128411
Gene: ENSMUSG00000028874
AA Change: V211E

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial reduction in hemorrhage following induction of a local Shwartzman reaction, and show enhanced NK-cell receptor-induced IFN-gamma production in natural killer (NK) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Fgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Fgr APN 4 132994924 missense probably damaging 0.99
IGL03089:Fgr APN 4 132986266 missense probably damaging 0.96
R1760:Fgr UTSW 4 132998342 missense possibly damaging 0.72
R1957:Fgr UTSW 4 132998362 missense probably benign
R2011:Fgr UTSW 4 132997521 missense probably damaging 1.00
R2109:Fgr UTSW 4 132998475 missense probably benign 0.32
R2351:Fgr UTSW 4 132997237 missense probably damaging 0.99
R2941:Fgr UTSW 4 132998423 missense probably benign
R3034:Fgr UTSW 4 132998496 critical splice donor site probably null
R4770:Fgr UTSW 4 132987291 missense probably damaging 0.99
R4847:Fgr UTSW 4 132994648 missense probably damaging 1.00
R5294:Fgr UTSW 4 132997500 missense probably benign 0.01
R5384:Fgr UTSW 4 132986353 critical splice donor site probably null
R5388:Fgr UTSW 4 132995031 missense probably damaging 1.00
R5650:Fgr UTSW 4 133000222 missense probably benign 0.13
R6947:Fgr UTSW 4 132995069 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTGGGCTCTGGGAATTC -3'
(R):5'- CAAGATTAGGAGGCATTGCTTG -3'

Sequencing Primer
(F):5'- GAATTCCTTTGGGGGCCTCC -3'
(R):5'- TGCTCTCCGTCTGCTCAG -3'
Posted On2015-09-24