Incidental Mutation 'R4590:Rnf157'
ID342769
Institutional Source Beutler Lab
Gene Symbol Rnf157
Ensembl Gene ENSMUSG00000052949
Gene Namering finger protein 157
SynonymsA130073L17Rik, 2610036E23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116336353-116413032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116359272 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000102006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100202] [ENSMUST00000106398]
Predicted Effect probably damaging
Transcript: ENSMUST00000100202
AA Change: V200A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097776
Gene: ENSMUSG00000052949
AA Change: V200A

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106398
AA Change: V200A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102006
Gene: ENSMUSG00000052949
AA Change: V200A

DomainStartEndE-ValueType
RING 277 315 5.64e-4 SMART
low complexity region 345 358 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 446 457 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148763
Predicted Effect probably benign
Transcript: ENSMUST00000149147
SMART Domains Protein: ENSMUSP00000122483
Gene: ENSMUSG00000052949

DomainStartEndE-ValueType
RING 102 140 5.64e-4 SMART
low complexity region 170 183 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 377 387 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: The gene supports neuronal survival and dendrite growth and maintenance and knockdown with siRNA induces apoptosis in neuronal tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Rnf157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Rnf157 APN 11 116362355 missense probably benign 0.20
IGL01146:Rnf157 APN 11 116350086 missense probably benign 0.00
IGL01955:Rnf157 APN 11 116359896 missense probably damaging 0.96
IGL02010:Rnf157 APN 11 116396226 missense probably damaging 1.00
IGL02194:Rnf157 APN 11 116347032 critical splice donor site probably null
IGL03092:Rnf157 APN 11 116347969 critical splice acceptor site probably null
PIT4362001:Rnf157 UTSW 11 116360317 missense probably damaging 1.00
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0022:Rnf157 UTSW 11 116349450 unclassified probably benign
R0036:Rnf157 UTSW 11 116396302 missense probably damaging 1.00
R0164:Rnf157 UTSW 11 116354810 splice site probably benign
R1476:Rnf157 UTSW 11 116354759 missense probably damaging 1.00
R1509:Rnf157 UTSW 11 116347095 missense probably benign
R1544:Rnf157 UTSW 11 116354362 splice site probably null
R1654:Rnf157 UTSW 11 116358715 missense probably damaging 1.00
R1820:Rnf157 UTSW 11 116354651 missense probably damaging 1.00
R2133:Rnf157 UTSW 11 116358694 missense possibly damaging 0.93
R4017:Rnf157 UTSW 11 116359241 critical splice donor site probably null
R4872:Rnf157 UTSW 11 116355472 missense possibly damaging 0.93
R4891:Rnf157 UTSW 11 116358670 missense probably damaging 1.00
R5608:Rnf157 UTSW 11 116396320 splice site probably null
R5870:Rnf157 UTSW 11 116347074 missense probably benign
R7171:Rnf157 UTSW 11 116362373 missense possibly damaging 0.83
R7376:Rnf157 UTSW 11 116360366 missense probably benign 0.35
X0020:Rnf157 UTSW 11 116360308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGGCTCTAAACACCATTACAG -3'
(R):5'- AACAGACCTAGACAGCTGCG -3'

Sequencing Primer
(F):5'- TTACAGACTCCGCCCTCAGAG -3'
(R):5'- TAGACAGCTGCGAGTCTGAC -3'
Posted On2015-09-24