Incidental Mutation 'R4590:Eml5'
ID342772
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98837341 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1009 (Y1009C)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065716
AA Change: Y970C

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y970C

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221662
Predicted Effect possibly damaging
Transcript: ENSMUST00000223282
AA Change: Y1009C

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACAAGTTCAGTCCAAGG -3'
(R):5'- CCTTGTCAAGGCTTTACTGAAC -3'

Sequencing Primer
(F):5'- CCTTTGCAAGAGACATTCTATGGC -3'
(R):5'- CAAGGCTTTACTGAACTTAGAGGTCC -3'
Posted On2015-09-24