Incidental Mutation 'R4591:Grid2'
ID 342821
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4591 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 64297086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 483 (G483V)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: G483V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: G483V

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,777,599 (GRCm39) S187P possibly damaging Het
4932438H23Rik T C 16: 90,852,959 (GRCm39) N59S probably damaging Het
Abca15 A T 7: 119,981,636 (GRCm39) D1030V probably damaging Het
Acmsd A T 1: 127,676,934 (GRCm39) N153I probably damaging Het
Adprh C A 16: 38,266,345 (GRCm39) V266L probably benign Het
Aldh5a1 G A 13: 25,107,991 (GRCm39) P217S probably damaging Het
Alpk2 A T 18: 65,438,894 (GRCm39) L1300Q probably benign Het
Alyref C T 11: 120,486,799 (GRCm39) R154Q probably benign Het
Ano6 T A 15: 95,841,308 (GRCm39) C468* probably null Het
Aox3 A T 1: 58,191,815 (GRCm39) I456F probably damaging Het
Art4 A G 6: 136,831,755 (GRCm39) Y129H probably damaging Het
Asb16 C A 11: 102,167,551 (GRCm39) H306N probably damaging Het
Atp8a2 C A 14: 59,892,078 (GRCm39) R1090L probably benign Het
Brap G T 5: 121,800,113 (GRCm39) V1F probably null Het
C1qb C A 4: 136,609,528 (GRCm39) G31W probably damaging Het
Cacna2d4 T C 6: 119,275,425 (GRCm39) Y666H probably benign Het
Casr T C 16: 36,320,732 (GRCm39) N472S probably benign Het
Ccdc91 T G 6: 147,491,963 (GRCm39) S282A unknown Het
Cd300lg A G 11: 101,937,006 (GRCm39) T164A probably benign Het
Cd79b A T 11: 106,202,872 (GRCm39) D243E probably damaging Het
Cdh6 C A 15: 13,051,572 (GRCm39) V354F possibly damaging Het
Cdhr2 A G 13: 54,863,497 (GRCm39) N126S probably benign Het
Cep192 A T 18: 67,968,039 (GRCm39) N841I probably damaging Het
Cngb1 T C 8: 95,980,012 (GRCm39) T963A probably damaging Het
Col16a1 A G 4: 129,955,592 (GRCm39) probably null Het
Coro1a A G 7: 126,302,164 (GRCm39) V61A probably damaging Het
Crocc T A 4: 140,745,983 (GRCm39) D1712V probably damaging Het
Ddn T C 15: 98,705,687 (GRCm39) D3G possibly damaging Het
Dnal1 T C 12: 84,180,627 (GRCm39) F89S probably benign Het
Dusp3 T A 11: 101,864,446 (GRCm39) probably benign Het
Dyrk3 C A 1: 131,057,895 (GRCm39) G58C probably damaging Het
Fat1 T C 8: 45,479,279 (GRCm39) F2775S probably benign Het
Frk A G 10: 34,481,829 (GRCm39) N373S probably benign Het
Glmn A G 5: 107,708,917 (GRCm39) probably null Het
Gm11565 A T 11: 99,805,769 (GRCm39) T54S possibly damaging Het
Gm14410 A G 2: 176,885,820 (GRCm39) I148T possibly damaging Het
Gm21834 T A 17: 58,048,880 (GRCm39) H112L possibly damaging Het
Gm5862 A G 5: 26,224,486 (GRCm39) I161T possibly damaging Het
Hfm1 A T 5: 106,995,533 (GRCm39) S1293T probably benign Het
Il1a G A 2: 129,148,447 (GRCm39) R88W probably damaging Het
Il20rb A T 9: 100,357,043 (GRCm39) V29D possibly damaging Het
Ilvbl C T 10: 78,419,139 (GRCm39) L463F probably benign Het
Kif17 A G 4: 138,005,110 (GRCm39) E225G probably benign Het
Lrp2 A G 2: 69,366,419 (GRCm39) F227L probably damaging Het
Lrrc43 A G 5: 123,639,227 (GRCm39) M419V probably benign Het
Magel2 A G 7: 62,030,837 (GRCm39) Q1247R unknown Het
Mamdc4 T A 2: 25,454,609 (GRCm39) M1068L possibly damaging Het
Mdn1 T G 4: 32,707,636 (GRCm39) S1642A probably damaging Het
Mtarc1 T C 1: 184,539,365 (GRCm39) E102G probably benign Het
Mtcl1 T C 17: 66,655,506 (GRCm39) E819G probably benign Het
Naa15 T C 3: 51,349,345 (GRCm39) L38P probably damaging Het
Nlrp3 A G 11: 59,440,048 (GRCm39) R542G probably benign Het
Or10c1 C T 17: 37,522,010 (GRCm39) V245I probably benign Het
Or4d2b A G 11: 87,780,375 (GRCm39) S116P probably benign Het
Or5ac19 A C 16: 59,089,776 (GRCm39) F85V possibly damaging Het
Or5b125-ps1 ACAC ACACGCAC 19: 13,056,266 (GRCm39) noncoding transcript Het
Pbxip1 T A 3: 89,353,467 (GRCm39) L249Q probably benign Het
Pla2g7 T C 17: 43,911,450 (GRCm39) S201P probably damaging Het
Psmd1 G T 1: 86,055,926 (GRCm39) V763F probably benign Het
Ptp4a2 A G 4: 129,740,308 (GRCm39) E124G probably benign Het
Rab6b T C 9: 103,044,373 (GRCm39) probably null Het
Rbks T A 5: 31,817,352 (GRCm39) K139M possibly damaging Het
Rgs22 T A 15: 36,100,282 (GRCm39) E268D probably benign Het
Slc16a9 T G 10: 70,118,710 (GRCm39) L343R probably damaging Het
Smagp T C 15: 100,519,860 (GRCm39) I55V probably damaging Het
Sox13 T C 1: 133,311,421 (GRCm39) S604G probably damaging Het
St6gal1 G T 16: 23,140,044 (GRCm39) V72F probably benign Het
Stxbp4 A G 11: 90,485,606 (GRCm39) V247A probably benign Het
Susd3 A T 13: 49,384,736 (GRCm39) M217K possibly damaging Het
Tas2r129 T A 6: 132,928,574 (GRCm39) N170K probably benign Het
Tmem245 C A 4: 56,910,204 (GRCm39) A515S probably damaging Het
Tpte T C 8: 22,817,791 (GRCm39) V259A probably benign Het
Trpa1 T C 1: 14,952,332 (GRCm39) probably null Het
Ttc28 G A 5: 111,371,147 (GRCm39) R532H probably damaging Het
Vwa5a A T 9: 38,646,916 (GRCm39) N529I possibly damaging Het
Zfp574 T C 7: 24,778,969 (GRCm39) probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAATGGGCTGATTAAGTACAGTTC -3'
(R):5'- CTCTTAAGCTCCATCCTATGAAAAC -3'

Sequencing Primer
(F):5'- GGGCTGATTAAGTACAGTTCAATAAC -3'
(R):5'- GCTCCATCCTATGAAAACAGCTTTC -3'
Posted On 2015-09-24