Incidental Mutation 'R4592:Dnm1'
ID342878
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32336011 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 352 (D352G)
Ref Sequence ENSEMBL: ENSMUSP00000143955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000091089] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000139238] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably damaging
Transcript: ENSMUST00000078352
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091089
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113350
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113352
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113365
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139238
SMART Domains Protein: ENSMUSP00000118855
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:Dynamin_N 34 57 2.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139624
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201433
AA Change: D352G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201494
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202578
AA Change: D352G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825
AA Change: D352G

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0180:Dnm1 UTSW 2 32327993 missense probably damaging 0.99
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R5926:Dnm1 UTSW 2 32315804 missense probably benign 0.00
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6463:Dnm1 UTSW 2 32309591 utr 3 prime probably benign
R6563:Dnm1 UTSW 2 32312726 missense probably damaging 1.00
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6707:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAAACTCCATCTGTGGTGAAC -3'
(R):5'- CAAGAACTTCCGACCGGATG -3'

Sequencing Primer
(F):5'- CAGACGGGGATGGGTCAGC -3'
(R):5'- AAGGCCCTGCTGCAGTAAG -3'
Posted On2015-09-24